ID: 1077945367

View in Genome Browser
Species Human (GRCh38)
Location 11:6891637-6891659
Sequence ATAGATGAGGGGATTAAGCA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 348
Summary {0: 1, 1: 1, 2: 9, 3: 50, 4: 287}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077945360_1077945367 13 Left 1077945360 11:6891601-6891623 CCTCAGAGCTGCCTTCACATCCT 0: 1
1: 0
2: 7
3: 57
4: 462
Right 1077945367 11:6891637-6891659 ATAGATGAGGGGATTAAGCATGG 0: 1
1: 1
2: 9
3: 50
4: 287
1077945363_1077945367 -7 Left 1077945363 11:6891621-6891643 CCTTGTTTCTCAGGCTATAGATG 0: 1
1: 61
2: 54
3: 54
4: 327
Right 1077945367 11:6891637-6891659 ATAGATGAGGGGATTAAGCATGG 0: 1
1: 1
2: 9
3: 50
4: 287
1077945361_1077945367 2 Left 1077945361 11:6891612-6891634 CCTTCACATCCTTGTTTCTCAGG 0: 1
1: 9
2: 14
3: 44
4: 325
Right 1077945367 11:6891637-6891659 ATAGATGAGGGGATTAAGCATGG 0: 1
1: 1
2: 9
3: 50
4: 287
1077945359_1077945367 28 Left 1077945359 11:6891586-6891608 CCTTGTGGCTACTTTCCTCAGAG 0: 1
1: 1
2: 1
3: 23
4: 183
Right 1077945367 11:6891637-6891659 ATAGATGAGGGGATTAAGCATGG 0: 1
1: 1
2: 9
3: 50
4: 287

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077945367 Original CRISPR ATAGATGAGGGGATTAAGCA TGG Exonic