ID: 1077945951

View in Genome Browser
Species Human (GRCh38)
Location 11:6898845-6898867
Sequence GTAAGATTATTAGAGGGTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077945951_1077945961 19 Left 1077945951 11:6898845-6898867 CCCCCACCCTCTAATAATCTTAC No data
Right 1077945961 11:6898887-6898909 GGAGAAAGATCAAATTGGCATGG No data
1077945951_1077945957 -2 Left 1077945951 11:6898845-6898867 CCCCCACCCTCTAATAATCTTAC No data
Right 1077945957 11:6898866-6898888 ACCAATATTTTGTCCTATGATGG No data
1077945951_1077945960 14 Left 1077945951 11:6898845-6898867 CCCCCACCCTCTAATAATCTTAC No data
Right 1077945960 11:6898882-6898904 ATGATGGAGAAAGATCAAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077945951 Original CRISPR GTAAGATTATTAGAGGGTGG GGG (reversed) Intergenic
No off target data available for this crispr