ID: 1077948296

View in Genome Browser
Species Human (GRCh38)
Location 11:6926547-6926569
Sequence CAATTTATGAAACTCGGAGC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 170
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 162}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077948290_1077948296 28 Left 1077948290 11:6926496-6926518 CCTTCCACAGCTGGTGCGCGTGC 0: 1
1: 0
2: 0
3: 6
4: 85
Right 1077948296 11:6926547-6926569 CAATTTATGAAACTCGGAGCCGG 0: 1
1: 0
2: 0
3: 7
4: 162
1077948291_1077948296 24 Left 1077948291 11:6926500-6926522 CCACAGCTGGTGCGCGTGCGCAA 0: 1
1: 0
2: 0
3: 3
4: 48
Right 1077948296 11:6926547-6926569 CAATTTATGAAACTCGGAGCCGG 0: 1
1: 0
2: 0
3: 7
4: 162

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077948296 Original CRISPR CAATTTATGAAACTCGGAGC CGG Exonic
903515349 1:23907092-23907114 TAATTTATGAATCTTGAAGCAGG + Intronic
905332001 1:37210602-37210624 AAATTAATGAATCTAGGAGCTGG + Intergenic
907717578 1:56941672-56941694 CAAATTATGAAACACGTACCTGG + Intronic
907991800 1:59589981-59590003 AAATTAATGAATCTAGGAGCTGG + Intronic
908631023 1:66106886-66106908 AAATTAATGAATCCCGGAGCTGG - Intronic
910067468 1:83170613-83170635 AAATTAATGAATCTAGGAGCTGG + Intergenic
910082057 1:83353384-83353406 AAATTAATGAATCTAGGAGCTGG - Intergenic
911359158 1:96856158-96856180 AAATTAATGAAACCAGGAGCTGG - Intergenic
915862124 1:159456007-159456029 AAATTAATGAATCTAGGAGCTGG + Intergenic
916460411 1:165018317-165018339 AAATTAATGAATCTGGGAGCTGG - Intergenic
919382812 1:196879393-196879415 CAATTTATGATACTTGGATCAGG - Intronic
920802719 1:209204593-209204615 CAATTTATGAAACTCCCACAAGG + Intergenic
921032635 1:211346879-211346901 CAATTTATGAAACAAGAAGATGG + Intronic
923903143 1:238351652-238351674 CAATTTATAAAACTCAGAATGGG - Intergenic
1063324692 10:5086023-5086045 AAATTAATGAAACCAGGAGCTGG - Intronic
1064671532 10:17719759-17719781 AAATTAATGAATCTAGGAGCTGG - Intergenic
1065486283 10:26239167-26239189 CAATTGATGGATCTCAGAGCTGG + Intronic
1068970435 10:62952802-62952824 AAATTAATGAATCTAGGAGCTGG + Intergenic
1069566877 10:69469355-69469377 CAAATTATCAAACTTGGAGAAGG + Intronic
1076143874 10:128101127-128101149 CCATTAATGTAACTGGGAGCTGG + Intronic
1077785238 11:5376506-5376528 AAATTAATGAATCTGGGAGCTGG + Intronic
1077948296 11:6926547-6926569 CAATTTATGAAACTCGGAGCCGG + Exonic
1079695609 11:23478515-23478537 AAATTTATGAAACTCTGAACAGG + Intergenic
1080059503 11:27942254-27942276 AAATTAATGAAACCAGGAGCTGG + Intergenic
1080093362 11:28375614-28375636 AAATTAATGAAACCAGGAGCTGG - Intergenic
1081434980 11:43017419-43017441 AAATTTATGAAACTTGGAGATGG + Intergenic
1081650277 11:44819021-44819043 CAATCCATGAAACTGGGACCTGG - Intronic
1083521354 11:63316179-63316201 AAATTAATGAATCTAGGAGCTGG + Intronic
1086117587 11:83269352-83269374 CAATCAATGAACCTAGGAGCTGG + Intronic
1086130481 11:83396433-83396455 AAATTAATGAATCTAGGAGCTGG + Intergenic
1087358271 11:97122864-97122886 CAGTTCATGAGACTTGGAGCTGG - Intergenic
1092323804 12:7507913-7507935 AAATTAATGAATCTGGGAGCTGG - Intergenic
1093272857 12:17085905-17085927 CAATTTAAGAAACTCAGAAAAGG - Intergenic
1094046777 12:26176135-26176157 CAATTTAAGAAACTCAGAATAGG - Intronic
1096931260 12:55212423-55212445 AAATTAATGAATCTAGGAGCTGG + Intergenic
1097408742 12:59224960-59224982 AAATTAATGAATCTAGGAGCTGG - Intergenic
1097562438 12:61223829-61223851 CAATTAATGAATCCAGGAGCTGG - Intergenic
1098791575 12:74830623-74830645 AGATTAATGAAACTAGGAGCTGG - Intergenic
1100874833 12:98950972-98950994 CAAATTAAGAATCTCCGAGCTGG - Intronic
1113049778 13:106198102-106198124 CAATGTATGAGACTCGGAATAGG - Intergenic
1119798538 14:77421907-77421929 CAATATATGAAACTTGCAGGTGG - Intronic
1120598571 14:86472317-86472339 AAATTAATGAATCTAGGAGCTGG + Intergenic
1121177603 14:91902768-91902790 TAGTTTCTGAAACTCTGAGCAGG - Intronic
1121652312 14:95567746-95567768 CAATTTATGAAAAAAGCAGCCGG - Intergenic
1137348973 16:47693891-47693913 CAATATAGGAAACTCTAAGCTGG - Intronic
1138012895 16:53399946-53399968 AAATTAATGAATCTAGGAGCTGG + Intergenic
1139257242 16:65554307-65554329 AAATTAATGAATCTAGGAGCTGG + Intergenic
1148840945 17:50496696-50496718 TAAATTATGAAAATCTGAGCAGG + Intergenic
1149059589 17:52406786-52406808 AAATTAATGAAACCAGGAGCTGG - Intergenic
1149286041 17:55165666-55165688 CAATATATGAAATTAGGGGCTGG - Intergenic
1156395713 18:36698086-36698108 CAATTCATGAAACACTGAACTGG - Intronic
1157970336 18:52260217-52260239 CAATTTATAAAAATTGTAGCAGG + Intergenic
1158792608 18:60799900-60799922 AAATTTATGAATCCAGGAGCTGG - Intergenic
1158967908 18:62638617-62638639 CAGTTTTAGAAACTCTGAGCTGG - Intergenic
1163901628 19:20106747-20106769 CAATTTATGAAAACCTGGGCCGG - Intronic
1164099368 19:22041136-22041158 CAATTAATGAACCTGTGAGCTGG + Intergenic
1167385378 19:49159969-49159991 CAATTTAGGAAACTCTGGTCTGG + Intronic
930941391 2:57018456-57018478 CAATTAATGAATCCAGGAGCTGG + Intergenic
934617350 2:95781646-95781668 AAATCAATGAAACTAGGAGCTGG + Intergenic
934643543 2:96042913-96042935 AAATCAATGAAACTAGGAGCTGG - Intergenic
934836952 2:97598981-97599003 AAATCAATGAAACTAGGAGCTGG - Intergenic
936279664 2:111126558-111126580 CAATTTAAGAAACTCACATCTGG - Intronic
940045526 2:149405681-149405703 CAATTAATGAATCCAGGAGCTGG - Intronic
940059359 2:149548033-149548055 CAATTAATGAATCCAGGAGCTGG - Intergenic
940671492 2:156674905-156674927 CAATTTAAGAAAATCTGGGCTGG + Intergenic
940994955 2:160138547-160138569 CAATCTATGCAACTCAGGGCAGG - Intronic
943303690 2:186233493-186233515 AAATTAATGAATCTAGGAGCTGG + Intergenic
943306893 2:186273767-186273789 CAATTTTTGAAACTCAGAAATGG - Intergenic
1171404810 20:24903651-24903673 AAATTAATGAATCTAGGAGCTGG + Intergenic
1172197752 20:33103630-33103652 CAATTTATAAAAAGCGGAGGTGG - Intronic
1173553317 20:43948522-43948544 TAATTAATGAAATTGGGAGCAGG + Intronic
1175674116 20:60932287-60932309 CAATGTATGAACCTCAGAGCTGG - Intergenic
1177787226 21:25684206-25684228 TAATTTGTGAAACTGGGAGATGG + Intronic
1178636766 21:34310549-34310571 CAATTCATGAAACTCAGACCTGG + Intergenic
949712723 3:6890179-6890201 AAATTAATGAATCTAGGAGCTGG - Intronic
950267430 3:11584948-11584970 CAAGTTGTGACACTTGGAGCCGG - Intronic
950412294 3:12846904-12846926 CAATTTCTGACACTTGGAACAGG + Intronic
951594106 3:24298562-24298584 CAATCTATGAAAATCAGAGACGG - Intronic
952747476 3:36794867-36794889 CAATGGATGAAACCAGGAGCTGG - Intergenic
953946349 3:47151496-47151518 CAGGATATGAAACTGGGAGCAGG - Intronic
956215659 3:66845978-66846000 AAATTAATGAATCTAGGAGCTGG + Intergenic
958087743 3:88833755-88833777 CATTATATGGAACTCAGAGCTGG + Intergenic
958527802 3:95285893-95285915 CAATTAATGAATCCAGGAGCTGG - Intergenic
958558739 3:95714731-95714753 CAATTTATGAATCTGTGAGAAGG + Intergenic
958767005 3:98380900-98380922 AAATTAATGAATCTAGGAGCTGG - Intergenic
958886781 3:99736099-99736121 AAATTAATGAATCTAGGAGCTGG - Intronic
959076098 3:101750860-101750882 CAATTAATGAATCCAGGAGCTGG - Intronic
959621211 3:108400360-108400382 CAATTCATGAAACAGGGACCTGG + Intronic
959910203 3:111755599-111755621 CAATTAATGAATCCAGGAGCTGG - Intronic
962484106 3:135825161-135825183 AAATTAATGAATCTAGGAGCTGG + Intergenic
962537091 3:136339625-136339647 CAATTTTTGAAACTGGGTGATGG - Intronic
962553805 3:136525543-136525565 AAATTAATGAATCTAGGAGCTGG - Intronic
964173653 3:153799981-153800003 AAATTAATGAATCTAGGAGCCGG + Intergenic
964685827 3:159395267-159395289 AAATTAATGAATCTAGGAGCTGG - Intronic
964928612 3:161987432-161987454 CAATTTATGAGACTGCAAGCAGG + Intergenic
965228640 3:166024048-166024070 AAATTAATGAATCTAGGAGCTGG - Intergenic
965268767 3:166585150-166585172 CAATTTGTGAAGCTGAGAGCTGG + Intergenic
969195204 4:5556627-5556649 CATTTTATGAAACCAGAAGCTGG + Intronic
969937365 4:10695768-10695790 TAATAAATGAAACTCTGAGCTGG - Intergenic
970348489 4:15177063-15177085 AAATTAATGAATCTAGGAGCTGG + Intergenic
971603090 4:28621079-28621101 CAATTTATGAATTTTGGAGAAGG + Intergenic
971804700 4:31341102-31341124 CAGTTTAAGAAACTCTGGGCAGG + Intergenic
974433827 4:61832157-61832179 CAATGTATGAGACTTGGAGAGGG + Intronic
976453052 4:85214568-85214590 AAATTTATGAAATTTGGAGTTGG - Intergenic
976532520 4:86171268-86171290 AAATTAATGAACCTAGGAGCTGG + Intronic
976795890 4:88931804-88931826 GCATTTATGAAACTCAGAGGTGG - Intronic
977856230 4:101897717-101897739 CAATTTATTAATCTGGGAGTAGG + Intronic
979760302 4:124394420-124394442 AAATTAATGAAACCAGGAGCTGG - Intergenic
982306681 4:153939602-153939624 CAAGTTATTAAACTTAGAGCTGG + Intergenic
984493960 4:180471583-180471605 AAATTAATGAATCTAGGAGCTGG + Intergenic
985307656 4:188561211-188561233 AAATTAATGAAACCAGGAGCTGG - Intergenic
990110180 5:52313771-52313793 CAATTAATGAATCCAGGAGCTGG + Intergenic
990290241 5:54342688-54342710 AAATTTATGCAACTTTGAGCTGG + Intergenic
990980602 5:61599591-61599613 CAATTTGTGAGACTTGGAGATGG + Intergenic
991108177 5:62866330-62866352 AAATTAATGAATCCCGGAGCTGG + Intergenic
991131109 5:63123118-63123140 AAATTTCTGAAACTCAAAGCAGG - Intergenic
993924905 5:93854403-93854425 AAATTCATGAATCTAGGAGCTGG - Intronic
994528254 5:100933036-100933058 AAATCAATGAAACTGGGAGCAGG - Intergenic
994948620 5:106428332-106428354 AAATTAATGAAACCAGGAGCTGG - Intergenic
994962713 5:106625730-106625752 AAATTAATGAAACCAGGAGCTGG - Intergenic
997087706 5:130820792-130820814 AAATTAATGAATCTAGGAGCTGG + Intergenic
999438591 5:151583600-151583622 CTATTTATTAATCTGGGAGCTGG + Intergenic
1006250873 6:32782779-32782801 CCAATTATGAAACTCTGAGTTGG - Intergenic
1009844423 6:69118133-69118155 CAAGTGATGAAACTGGGAACCGG - Intronic
1010069485 6:71726530-71726552 CTATTTATGAACCTAGAAGCAGG - Intergenic
1011365079 6:86572753-86572775 AAATTAATGAATCTAGGAGCTGG + Intergenic
1011533958 6:88355563-88355585 AAATTAATGAATCTGGGAGCTGG + Intergenic
1012111856 6:95245285-95245307 CAATTTAAGAAATTAGGAGAAGG + Intergenic
1013855737 6:114569954-114569976 CAATTATTGAAGCCCGGAGCGGG - Intergenic
1014704466 6:124728751-124728773 AAATTAATGAAACCAGGAGCTGG + Intronic
1015671743 6:135698664-135698686 AAATTTATGAAACCCCAAGCTGG + Intergenic
1016667793 6:146663381-146663403 CCATTTATGAACCAGGGAGCAGG - Intronic
1018814286 6:167319173-167319195 CAATTTATGAAACTCTTAATAGG + Intergenic
1020580051 7:9986088-9986110 CAATTTATGCAACTTGAAGATGG + Intergenic
1021373594 7:19880595-19880617 AAATTAATGAATCTAGGAGCTGG - Intergenic
1022672346 7:32467595-32467617 AAATTAATGAATCTAGGAGCTGG + Intergenic
1026175049 7:67989387-67989409 CACTTTATGTGACTCGAAGCCGG + Intergenic
1027276637 7:76564143-76564165 AAATTAATGAATCTAGGAGCTGG - Intergenic
1028447862 7:90945405-90945427 CTGTTTATGAAACTCTGGGCAGG + Intronic
1031673582 7:124581496-124581518 AAATTAATGAATCTAGGAGCTGG - Intergenic
1032854680 7:135824587-135824609 CAATTTATAAAACTAGGATTTGG - Intergenic
1036073095 8:5463788-5463810 AAATTAATGAATCTAGGAGCTGG - Intergenic
1040553698 8:48460161-48460183 AAATTAATGAATCTAGGAGCTGG - Intergenic
1041865463 8:62568273-62568295 CAACTAATTAAACTCAGAGCTGG - Intronic
1042390442 8:68228110-68228132 CAATGTATGAAACTGGGAGGGGG - Intronic
1045202453 8:99998356-99998378 CAATTTATGAAACTTAAAGGTGG + Intronic
1045372049 8:101534226-101534248 CACTTTATGAAACCCTGAGCCGG - Intronic
1045979610 8:108169440-108169462 AAATTAATGAAACCAGGAGCTGG + Intergenic
1047840618 8:128747670-128747692 CAATTAATGAATCCAGGAGCTGG + Intergenic
1055497069 9:76866597-76866619 CAATTTTTGAAGCTGGGAGATGG + Intronic
1059730281 9:117050343-117050365 CACTTTGTGAAAATAGGAGCAGG + Intronic
1203358630 Un_KI270442v1:190641-190663 AAATTAATGAATCTAGGAGCTGG - Intergenic
1186237202 X:7526317-7526339 AAATTAATGAATCTAGGAGCTGG + Intergenic
1188226143 X:27600435-27600457 CAATTTATGAAATACTGAGATGG - Intronic
1188267669 X:28097318-28097340 AAATTAATGAATCTAGGAGCTGG - Intergenic
1189391200 X:40578314-40578336 CAATCTATGAAACAAGGAGAGGG + Intergenic
1189770717 X:44423761-44423783 AAATTTATAAGACTTGGAGCAGG - Intergenic
1190519731 X:51265193-51265215 AAATTTATGAATCCAGGAGCTGG + Intergenic
1191050590 X:56187067-56187089 AAATTAATGAATCTAGGAGCTGG + Intergenic
1191757037 X:64604393-64604415 AAATTAATGAATCTAGGAGCTGG - Intergenic
1191929076 X:66349142-66349164 AAATTAATGAATCTAGGAGCTGG + Intergenic
1192842901 X:74875942-74875964 AAATTAATGAATCTAGGAGCTGG - Intronic
1196162861 X:112505093-112505115 AAATTTATGAATCCAGGAGCTGG + Intergenic
1197901770 X:131381285-131381307 AAATTAATGAAACCAGGAGCTGG - Intronic
1197957128 X:131963640-131963662 AAATTAATGAATCTAGGAGCTGG + Intergenic
1199669701 X:150133553-150133575 AAATTAATGAAACCAGGAGCTGG + Intergenic
1200574354 Y:4869545-4869567 AAATTAATGAATCTAGGAGCTGG + Intergenic
1200903389 Y:8456383-8456405 AAATTAATGAAACCAGGAGCTGG - Intergenic
1201053455 Y:9964558-9964580 AAATTTATGAATCCAGGAGCTGG - Intergenic
1201606281 Y:15789133-15789155 AAATTAATGAATCTAGGAGCTGG - Intergenic