ID: 1077962439

View in Genome Browser
Species Human (GRCh38)
Location 11:7089566-7089588
Sequence AGCGTGGGCCGCCGCCGCGC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 142
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 126}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077962435_1077962439 -9 Left 1077962435 11:7089552-7089574 CCCGATGCCCATGAAGCGTGGGC 0: 1
1: 0
2: 1
3: 7
4: 106
Right 1077962439 11:7089566-7089588 AGCGTGGGCCGCCGCCGCGCAGG 0: 1
1: 0
2: 1
3: 14
4: 126
1077962430_1077962439 1 Left 1077962430 11:7089542-7089564 CCTCCAGGGCCCCGATGCCCATG 0: 1
1: 1
2: 3
3: 11
4: 229
Right 1077962439 11:7089566-7089588 AGCGTGGGCCGCCGCCGCGCAGG 0: 1
1: 0
2: 1
3: 14
4: 126
1077962431_1077962439 -2 Left 1077962431 11:7089545-7089567 CCAGGGCCCCGATGCCCATGAAG 0: 1
1: 0
2: 1
3: 15
4: 131
Right 1077962439 11:7089566-7089588 AGCGTGGGCCGCCGCCGCGCAGG 0: 1
1: 0
2: 1
3: 14
4: 126
1077962428_1077962439 9 Left 1077962428 11:7089534-7089556 CCTGCGGCCCTCCAGGGCCCCGA 0: 1
1: 0
2: 3
3: 24
4: 331
Right 1077962439 11:7089566-7089588 AGCGTGGGCCGCCGCCGCGCAGG 0: 1
1: 0
2: 1
3: 14
4: 126
1077962436_1077962439 -10 Left 1077962436 11:7089553-7089575 CCGATGCCCATGAAGCGTGGGCC 0: 1
1: 0
2: 1
3: 7
4: 93
Right 1077962439 11:7089566-7089588 AGCGTGGGCCGCCGCCGCGCAGG 0: 1
1: 0
2: 1
3: 14
4: 126
1077962433_1077962439 -8 Left 1077962433 11:7089551-7089573 CCCCGATGCCCATGAAGCGTGGG 0: 1
1: 0
2: 1
3: 5
4: 73
Right 1077962439 11:7089566-7089588 AGCGTGGGCCGCCGCCGCGCAGG 0: 1
1: 0
2: 1
3: 14
4: 126
1077962429_1077962439 2 Left 1077962429 11:7089541-7089563 CCCTCCAGGGCCCCGATGCCCAT 0: 1
1: 1
2: 2
3: 15
4: 164
Right 1077962439 11:7089566-7089588 AGCGTGGGCCGCCGCCGCGCAGG 0: 1
1: 0
2: 1
3: 14
4: 126

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077962439 Original CRISPR AGCGTGGGCCGCCGCCGCGC AGG Exonic
903939820 1:26921937-26921959 CGGGTGGGCCGACGCCGCGCGGG - Intronic
904326401 1:29729516-29729538 AGTGTGAGCCGCCTCCGTGCTGG - Intergenic
907906116 1:58784581-58784603 ACCGGCGGCCGCCACCGCGCGGG + Intergenic
908714299 1:67053782-67053804 GGCCTGGGCCGCCGCCGCCTCGG + Intronic
910876737 1:91885649-91885671 TGCGTGGGCAGCGGCCGCACGGG - Intronic
916414116 1:164576713-164576735 AGAGAGGGCCGCCGCCCCCCAGG + Intronic
921207287 1:212859160-212859182 AGCTTGTGCCACCGCCGTGCTGG + Exonic
922802680 1:228371461-228371483 AGCAGGTGCCGCCGCCGGGCCGG - Exonic
924511299 1:244730825-244730847 AGCGGGGCCCCCCTCCGCGCGGG - Intergenic
1067110626 10:43397168-43397190 GGCGTGGTGAGCCGCCGCGCGGG - Intronic
1067436600 10:46283108-46283130 TGGGTGGGCGGCCCCCGCGCGGG - Intergenic
1071518313 10:86313762-86313784 AGAGTGGGACGCCCCAGCGCAGG - Intronic
1073812370 10:107164726-107164748 GGAGCGAGCCGCCGCCGCGCGGG + Intergenic
1075430296 10:122374764-122374786 AGCCGGGGCCGCGGCGGCGCGGG + Exonic
1075690174 10:124389069-124389091 GGCGTGGGCTGCGGCCCCGCGGG - Intergenic
1076696099 10:132248143-132248165 AGCCCGGGCCGCGGCCGCACAGG + Intronic
1077064956 11:637026-637048 AGCATCGCCCGGCGCCGCGCGGG - Intergenic
1077378742 11:2218006-2218028 AGCGTGGGCTGCCCCTGGGCTGG - Intergenic
1077962439 11:7089566-7089588 AGCGTGGGCCGCCGCCGCGCAGG + Exonic
1078988090 11:16613948-16613970 AGCGTGGCCCGCCCGCCCGCAGG - Intronic
1079353498 11:19712805-19712827 AGCGCGCGCCGCAGCAGCGCCGG + Intronic
1080540263 11:33257902-33257924 AGCGAGGGGCGCCGCCACCCCGG + Intronic
1084598393 11:70130799-70130821 AGGGTGGGCCTCCGCTGCACCGG + Intronic
1085052674 11:73387847-73387869 AGCGGGGGCCTCAGCCGCGGCGG + Intronic
1091286829 11:134412454-134412476 AGCGGGAGCCGCCTCCGCGGGGG - Intergenic
1094040173 12:26114124-26114146 AGAGCGGGCCGCGGCCGGGCGGG - Intergenic
1095687344 12:45050898-45050920 GGCGTGGGCTGCGACCGCGCTGG + Exonic
1102038273 12:109784315-109784337 ACCGTGGGCCGCCTCCGCAGGGG - Exonic
1102101308 12:110281100-110281122 AGCGTGGGCGCCAGGCGCGCGGG + Intronic
1105472083 13:20703768-20703790 CGCGCGGGCCGGCGCCGGGCTGG + Intronic
1111951276 13:94711389-94711411 AGCGGCGGCCGCCGCCGCCGGGG - Exonic
1113254848 13:108495728-108495750 AGAGAGAGCCGCCGCCGAGCGGG + Intergenic
1113680275 13:112238908-112238930 AGCGTCAGCCGCCTCCCCGCGGG + Intergenic
1115851302 14:37592323-37592345 AACCTGGGCCGCAGCCGCGCGGG - Exonic
1125535883 15:40441093-40441115 AGCGGGGACCGCGGCCGGGCGGG - Intronic
1128161017 15:65422904-65422926 TGCTTCGGCCGCCGCCGCGGGGG + Exonic
1128453381 15:67819924-67819946 GGCCAGGGCCGCCGCCGCGCCGG + Intronic
1130115415 15:81001374-81001396 AGGGCGTGCCGCCGCGGCGCCGG + Exonic
1130115417 15:81001382-81001404 AGCGCGGCCCGGCGCCGCGGCGG - Exonic
1131049022 15:89334422-89334444 AGGGTGGGCCGCCGTCCCCCGGG + Intronic
1132319991 15:100918975-100918997 TGTGTGGGCCGCAGGCGCGCTGG + Intergenic
1132915282 16:2340585-2340607 CGCGCCGGCCGCCGCCGCCCCGG - Exonic
1133933720 16:10252387-10252409 AGCCCGGGCTGCCGCCGCGGCGG + Intergenic
1136611963 16:31371800-31371822 AACGTGGGTGGCGGCCGCGCTGG + Intronic
1136927661 16:34389195-34389217 AGCGAGGGCGGCAGCCGCGGCGG + Intergenic
1136976913 16:35022611-35022633 AGCGAGGGCGGCAGCCGCGGCGG - Exonic
1137531740 16:49282344-49282366 CGCGAGGGCAGCCGGCGCGCTGG + Intergenic
1138591251 16:58000727-58000749 CGCATTGGCCGCCGCCGCCCGGG - Intronic
1141830124 16:86505747-86505769 CGCGAGGGCAGCCGCCCCGCCGG - Intergenic
1141989748 16:87602984-87603006 GGCGCGGGCGGCCGCGGCGCCGG - Exonic
1142350068 16:89575735-89575757 GGCTCGGGCGGCCGCCGCGCGGG - Intergenic
1142811801 17:2399023-2399045 GCCGTGTGCCGCCGCCGCGGCGG - Intronic
1143495022 17:7307844-7307866 AGCGGCGGCCGCCGCCGCACGGG + Intronic
1143904609 17:10198716-10198738 AACGCGGGCTGCCGCCGCGAGGG + Intergenic
1150168366 17:62966225-62966247 CGCTAGCGCCGCCGCCGCGCTGG - Intergenic
1151674100 17:75589120-75589142 GCCGTGGGCCCCCGCCGCGCTGG + Intergenic
1154143995 18:11851236-11851258 AGCGTTCCCCGCCGCAGCGCCGG + Intronic
1154325429 18:13387515-13387537 AGCAGGGACCGCCGCCGCCCAGG + Exonic
1156008445 18:32470480-32470502 AGCGGCGGCCGCCGAGGCGCGGG - Intronic
1157279031 18:46333948-46333970 AGCGGGGACCGCGGGCGCGCGGG - Intronic
1157794249 18:50560040-50560062 AGCCTGCGCCGCCGCCGCCTCGG - Intergenic
1160902092 19:1433761-1433783 AGTGTGGGCCGCAGCCCGGCGGG - Intronic
1160991703 19:1862913-1862935 CGCCCGGGCCGCCGCCGCGCCGG - Intronic
1161204986 19:3036280-3036302 AGCCTGGGCGGGAGCCGCGCGGG - Intronic
1161257998 19:3320416-3320438 AGAGTGGGCGGCGGCCGGGCGGG - Intergenic
1162118248 19:8445204-8445226 AGCCGGGGCCGAGGCCGCGCCGG - Intronic
1162312007 19:9913463-9913485 ATCGTGAGTGGCCGCCGCGCGGG - Intronic
1162373599 19:10292678-10292700 AGCTTGGGCCCCAGCTGCGCAGG - Exonic
1163106330 19:15125030-15125052 AGCGGGGGCGGCGGCCGCGGGGG + Exonic
1163243129 19:16076444-16076466 GGCGGGGGCGGCCCCCGCGCAGG + Intronic
1163431231 19:17268936-17268958 AGCGTGGGCAGCCGCAGCGAGGG + Exonic
1163596787 19:18225255-18225277 AACGAGGGCCGGCCCCGCGCAGG - Intronic
1163793303 19:19320885-19320907 AGCCTGGGCCGCCGCCGCCTGGG - Exonic
1165243063 19:34482319-34482341 AGCGCGGGCTGCCGTGGCGCTGG - Exonic
925170008 2:1744517-1744539 GACGTGGGCCGCGGCCGGGCGGG - Intronic
932380374 2:71276670-71276692 AGCCTGGGCTGCCGCCGGGGTGG - Intronic
932692744 2:73927077-73927099 AGCCTTGGCCTCCGCCACGCAGG + Intronic
935196627 2:100820193-100820215 CTCCTGGGCCGCAGCCGCGCGGG - Exonic
943669796 2:190648863-190648885 GGCGTGGGCCGCCGCCGGGCGGG - Intronic
946373498 2:219294753-219294775 CGCGTGGGCCAGCTCCGCGCCGG - Intronic
1168796255 20:611835-611857 AGCATGGGCCCCCTCCCCGCAGG + Intergenic
1171858887 20:30376869-30376891 AGCGCGGGCCACTCCCGCGCAGG - Intergenic
1175926974 20:62475854-62475876 AGAGCGGGGCCCCGCCGCGCTGG + Intronic
1176125390 20:63472651-63472673 CGCCTGGCCCGCGGCCGCGCCGG + Intergenic
1176135721 20:63521199-63521221 AGCGGGTGGAGCCGCCGCGCTGG - Intronic
1177941810 21:27421004-27421026 GCCATGGGCCGCCGCCCCGCGGG - Intergenic
1178859515 21:36277191-36277213 AGCGTGGGCCGCACCCTCCCAGG + Intronic
1178992689 21:37367848-37367870 AGCGGGGGCCGCGGCCTCCCGGG + Intronic
1179605670 21:42513903-42513925 AGCGCGGGCCTCGGCGGCGCAGG + Exonic
1182098600 22:27642302-27642324 AGCGTGGGCGGCCGCAGAGATGG + Intergenic
1182294941 22:29307096-29307118 AGCGGGGGCCGGAGCCGGGCCGG - Exonic
1183578252 22:38706153-38706175 AGCGCCCGCCGCCGCCGCCCGGG - Intronic
1183671957 22:39278240-39278262 AGCCTCGGCCGCCGCCTCCCGGG + Intergenic
1184659825 22:45960595-45960617 AGCGTGGGCCGCAGGAGCCCAGG - Intronic
1185055260 22:48575857-48575879 AGCCTGGCCCGCCGCGGCGGCGG + Intronic
950454754 3:13086008-13086030 AACTTGGGCCGCCGCAGGGCTGG + Intergenic
950894924 3:16440134-16440156 AGAGTGGGCCGCTGCCGCGAGGG + Intronic
951898358 3:27632797-27632819 GGCGGGGGCGGCCCCCGCGCAGG + Intergenic
955195553 3:56802017-56802039 AGCGTGGGGCGGTGCCGAGCCGG - Intronic
968110781 3:196044905-196044927 AGCGTGAGCCACCGCCCGGCCGG - Intronic
968193512 3:196688530-196688552 AGCGTGGGCAGCAGCAGCGTGGG - Intronic
968512976 4:1003402-1003424 AGCGACGGCAGCCGCAGCGCGGG - Exonic
969601322 4:8178119-8178141 ATCGTGGGCGGCCTCCACGCAGG + Intergenic
969715774 4:8867540-8867562 AGCGCAGGCCGCGGCCGGGCGGG - Exonic
972960649 4:44448421-44448443 CGCGTCGGCCGCCGCCGCCCCGG - Exonic
977536435 4:98260910-98260932 AGGCTGGGCCGCCGCAGAGCCGG - Intergenic
981315588 4:143336958-143336980 AGCCGGGGCCGCGGGCGCGCCGG - Exonic
981688511 4:147481244-147481266 AGCCGAAGCCGCCGCCGCGCCGG + Exonic
983649708 4:170026208-170026230 AGCGGGGGCCCCCGGCGGGCCGG - Intronic
986330663 5:6714068-6714090 GGCGTGGGCCGCGGCGGCTCGGG + Intergenic
998132522 5:139658609-139658631 AGCGTGGGCAGCGGGCGGGCGGG - Intronic
998279941 5:140796398-140796420 AGCGTGGGATGCGGACGCGCAGG + Exonic
998281143 5:140808621-140808643 TGCGTGGGACGCGGACGCGCAGG + Exonic
998285591 5:140857479-140857501 TGCGTGGGACGCGGACGCGCAGG + Exonic
1002897997 6:1390170-1390192 AGCGCGGGCGGCGGCGGCGCGGG + Exonic
1003074480 6:2971388-2971410 CGCGTGGGTCGACGGCGCGCGGG - Intronic
1006300927 6:33193173-33193195 GACGTGGGCCGCCTCCGGGCGGG + Intergenic
1006589190 6:35141604-35141626 AGCGTGTGCCGCAGGGGCGCAGG + Exonic
1007431487 6:41779828-41779850 AGCGGGGCCCGGCGCCGCCCGGG - Exonic
1007442773 6:41877838-41877860 GGCGTGGGCCACCACCACGCTGG + Intronic
1016863960 6:148747768-148747790 ACCGCGCGCCGCCGCCGCCCCGG + Intronic
1019531307 7:1504707-1504729 AGCGGGGGCGGCCGGGGCGCAGG + Intergenic
1023638416 7:42236479-42236501 CGCGGGGGCCGCCGCCGCTGGGG - Intronic
1026776543 7:73234697-73234719 AGCGGGGGGCGCCGCCCCGCAGG + Intergenic
1027017394 7:74788067-74788089 AGCGGGGGGCGCCGCCCCGCAGG + Exonic
1027070628 7:75157865-75157887 AGCGGGGGGCGCCGCCCCGCAGG - Intergenic
1029270484 7:99374455-99374477 AGCCTGAGCCGCCGCTGGGCTGG - Intronic
1029658504 7:101943479-101943501 GACGTCAGCCGCCGCCGCGCGGG - Intronic
1031051852 7:116953369-116953391 CGCGCGGGCCGCGGGCGCGCCGG - Exonic
1032306069 7:130733614-130733636 AGCGCAGACCGCCGCGGCGCCGG + Exonic
1037305185 8:17497130-17497152 AGCAGCGGCCGCCGCCTCGCTGG - Intronic
1037855416 8:22367663-22367685 AGCGTGGGTCGCCGCGCCGAAGG + Intronic
1037989070 8:23307668-23307690 AGCGTCAGCCCCCGCCGCCCAGG + Intronic
1043502860 8:80873992-80874014 AGCCTGGGCAGCCGCCGGGGGGG - Intronic
1049801124 8:144517960-144517982 ATCGCGGGGCGCCGCGGCGCCGG + Intergenic
1052991820 9:34523029-34523051 AGCGAGCGCCGCGGCCGCGGAGG - Exonic
1057490516 9:95516436-95516458 GGCGTCGGCGGCCGCCGCGCTGG + Intronic
1060713079 9:125889933-125889955 AGCCGGGGCCGCCGGCGCGGGGG - Intronic
1186669478 X:11755440-11755462 TGCGTCGCCCGCCGCCCCGCTGG - Intergenic
1187172914 X:16869741-16869763 GGCGGGGGCCGCCTCCGCCCCGG + Exonic
1199772558 X:150983918-150983940 GGCTTGGCCCGGCGCCGCGCGGG + Intronic
1200058772 X:153474822-153474844 TGCGCGGGGCGCAGCCGCGCAGG + Intronic