ID: 1077962439

View in Genome Browser
Species Human (GRCh38)
Location 11:7089566-7089588
Sequence AGCGTGGGCCGCCGCCGCGC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 142
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 126}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077962431_1077962439 -2 Left 1077962431 11:7089545-7089567 CCAGGGCCCCGATGCCCATGAAG 0: 1
1: 0
2: 1
3: 15
4: 131
Right 1077962439 11:7089566-7089588 AGCGTGGGCCGCCGCCGCGCAGG 0: 1
1: 0
2: 1
3: 14
4: 126
1077962435_1077962439 -9 Left 1077962435 11:7089552-7089574 CCCGATGCCCATGAAGCGTGGGC 0: 1
1: 0
2: 1
3: 7
4: 106
Right 1077962439 11:7089566-7089588 AGCGTGGGCCGCCGCCGCGCAGG 0: 1
1: 0
2: 1
3: 14
4: 126
1077962436_1077962439 -10 Left 1077962436 11:7089553-7089575 CCGATGCCCATGAAGCGTGGGCC 0: 1
1: 0
2: 1
3: 7
4: 93
Right 1077962439 11:7089566-7089588 AGCGTGGGCCGCCGCCGCGCAGG 0: 1
1: 0
2: 1
3: 14
4: 126
1077962433_1077962439 -8 Left 1077962433 11:7089551-7089573 CCCCGATGCCCATGAAGCGTGGG 0: 1
1: 0
2: 1
3: 5
4: 73
Right 1077962439 11:7089566-7089588 AGCGTGGGCCGCCGCCGCGCAGG 0: 1
1: 0
2: 1
3: 14
4: 126
1077962430_1077962439 1 Left 1077962430 11:7089542-7089564 CCTCCAGGGCCCCGATGCCCATG 0: 1
1: 1
2: 3
3: 11
4: 229
Right 1077962439 11:7089566-7089588 AGCGTGGGCCGCCGCCGCGCAGG 0: 1
1: 0
2: 1
3: 14
4: 126
1077962428_1077962439 9 Left 1077962428 11:7089534-7089556 CCTGCGGCCCTCCAGGGCCCCGA 0: 1
1: 0
2: 3
3: 24
4: 331
Right 1077962439 11:7089566-7089588 AGCGTGGGCCGCCGCCGCGCAGG 0: 1
1: 0
2: 1
3: 14
4: 126
1077962429_1077962439 2 Left 1077962429 11:7089541-7089563 CCCTCCAGGGCCCCGATGCCCAT 0: 1
1: 1
2: 2
3: 15
4: 164
Right 1077962439 11:7089566-7089588 AGCGTGGGCCGCCGCCGCGCAGG 0: 1
1: 0
2: 1
3: 14
4: 126

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077962439 Original CRISPR AGCGTGGGCCGCCGCCGCGC AGG Exonic