ID: 1077962505 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 11:7089786-7089808 |
| Sequence | CCCGGGGTTCGCGGTAGTCT CGG (reversed) |
| Strand | - |
| Crispr in exon? | Yes |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 37 | |||
| Summary | {0: 1, 1: 0, 2: 0, 3: 1, 4: 35} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1077962505_1077962519 | 20 | Left | 1077962505 | 11:7089786-7089808 | CCGAGACTACCGCGAACCCCGGG | 0: 1 1: 0 2: 0 3: 1 4: 35 |
||
| Right | 1077962519 | 11:7089829-7089851 | GAGTACACCCACCGCGATTACGG | 0: 1 1: 0 2: 0 3: 3 4: 77 |
||||
| 1077962505_1077962512 | -4 | Left | 1077962505 | 11:7089786-7089808 | CCGAGACTACCGCGAACCCCGGG | 0: 1 1: 0 2: 0 3: 1 4: 35 |
||
| Right | 1077962512 | 11:7089805-7089827 | CGGGGTTTTGCCCCCTCGCCCGG | 0: 1 1: 0 2: 1 3: 15 4: 304 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1077962505 | Original CRISPR | CCCGGGGTTCGCGGTAGTCT CGG (reversed) | Exonic | ||