ID: 1077962505

View in Genome Browser
Species Human (GRCh38)
Location 11:7089786-7089808
Sequence CCCGGGGTTCGCGGTAGTCT CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 37
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 35}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077962505_1077962519 20 Left 1077962505 11:7089786-7089808 CCGAGACTACCGCGAACCCCGGG 0: 1
1: 0
2: 0
3: 1
4: 35
Right 1077962519 11:7089829-7089851 GAGTACACCCACCGCGATTACGG 0: 1
1: 0
2: 0
3: 3
4: 77
1077962505_1077962512 -4 Left 1077962505 11:7089786-7089808 CCGAGACTACCGCGAACCCCGGG 0: 1
1: 0
2: 0
3: 1
4: 35
Right 1077962512 11:7089805-7089827 CGGGGTTTTGCCCCCTCGCCCGG 0: 1
1: 0
2: 1
3: 15
4: 304

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077962505 Original CRISPR CCCGGGGTTCGCGGTAGTCT CGG (reversed) Exonic