ID: 1077965935

View in Genome Browser
Species Human (GRCh38)
Location 11:7133533-7133555
Sequence TATGCAGGACCTCAAGAAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077965929_1077965935 18 Left 1077965929 11:7133492-7133514 CCTCCAATGAAAGCAAAGCAAAC No data
Right 1077965935 11:7133533-7133555 TATGCAGGACCTCAAGAAAGGGG No data
1077965928_1077965935 21 Left 1077965928 11:7133489-7133511 CCACCTCCAATGAAAGCAAAGCA No data
Right 1077965935 11:7133533-7133555 TATGCAGGACCTCAAGAAAGGGG No data
1077965930_1077965935 15 Left 1077965930 11:7133495-7133517 CCAATGAAAGCAAAGCAAACAGC No data
Right 1077965935 11:7133533-7133555 TATGCAGGACCTCAAGAAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077965935 Original CRISPR TATGCAGGACCTCAAGAAAG GGG Intergenic
No off target data available for this crispr