ID: 1077972824

View in Genome Browser
Species Human (GRCh38)
Location 11:7213097-7213119
Sequence CTGAGGAATGGTAAGGAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077972820_1077972824 -10 Left 1077972820 11:7213084-7213106 CCAACACAGGATGCTGAGGAATG No data
Right 1077972824 11:7213097-7213119 CTGAGGAATGGTAAGGAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077972824 Original CRISPR CTGAGGAATGGTAAGGAGGA TGG Intergenic
No off target data available for this crispr