ID: 1077976264

View in Genome Browser
Species Human (GRCh38)
Location 11:7251859-7251881
Sequence CGCTACTCGCGGCCGCCGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 77
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 71}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077976264_1077976275 7 Left 1077976264 11:7251859-7251881 CCCCCCGGCGGCCGCGAGTAGCG 0: 1
1: 0
2: 0
3: 5
4: 71
Right 1077976275 11:7251889-7251911 CGCAAGCAGAGAGGCGCTCTGGG 0: 1
1: 0
2: 0
3: 5
4: 60
1077976264_1077976273 -2 Left 1077976264 11:7251859-7251881 CCCCCCGGCGGCCGCGAGTAGCG 0: 1
1: 0
2: 0
3: 5
4: 71
Right 1077976273 11:7251880-7251902 CGGGCGGAGCGCAAGCAGAGAGG 0: 1
1: 0
2: 0
3: 5
4: 100
1077976264_1077976274 6 Left 1077976264 11:7251859-7251881 CCCCCCGGCGGCCGCGAGTAGCG 0: 1
1: 0
2: 0
3: 5
4: 71
Right 1077976274 11:7251888-7251910 GCGCAAGCAGAGAGGCGCTCTGG 0: 1
1: 0
2: 1
3: 11
4: 96
1077976264_1077976276 15 Left 1077976264 11:7251859-7251881 CCCCCCGGCGGCCGCGAGTAGCG 0: 1
1: 0
2: 0
3: 5
4: 71
Right 1077976276 11:7251897-7251919 GAGAGGCGCTCTGGGCTGTGCGG 0: 1
1: 1
2: 4
3: 35
4: 283

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077976264 Original CRISPR CGCTACTCGCGGCCGCCGGG GGG (reversed) Intronic
901673097 1:10867292-10867314 CGCCGCCCGCGGCCGCCGGTAGG - Intergenic
904696775 1:32335681-32335703 CGGCACTCGGGGCGGCCGGGGGG + Intronic
905167021 1:36088772-36088794 CGCGACTCCGGGCCGCTGGGCGG + Intergenic
905643672 1:39609785-39609807 CGCTCCTCCCGGCCGCCAGAGGG - Intergenic
906650394 1:47508617-47508639 CGCTCCCCGCCCCCGCCGGGGGG + Intergenic
915161316 1:153922673-153922695 CGCTCCTCACCGCCCCCGGGCGG + Intronic
915740255 1:158113690-158113712 GGCTCCGGGCGGCCGCCGGGGGG - Intergenic
920278828 1:204828567-204828589 CGCTCCTAGCGGCCGCTGAGCGG - Intergenic
920641040 1:207752219-207752241 GGACACTCGCGGCGGCCGGGAGG - Exonic
1063504019 10:6580177-6580199 CGCCCCGCGCCGCCGCCGGGAGG - Intronic
1064122886 10:12634772-12634794 CGCTTCTCTCTGCCGCTGGGAGG + Intronic
1070129690 10:73647814-73647836 CGCTGCTCGCGAGCGCTGGGGGG + Exonic
1073520257 10:104121904-104121926 CGCTGCTCTCGGGCGCTGGGCGG + Intergenic
1074556128 10:114492075-114492097 AGCTACTCGTGGCTGCCTGGTGG + Intronic
1077440031 11:2563964-2563986 AGATACTCGGGGCCGCTGGGTGG + Intronic
1077976264 11:7251859-7251881 CGCTACTCGCGGCCGCCGGGGGG - Intronic
1083571358 11:63763722-63763744 CGCTGCTCCCGGCTGCGGGGCGG + Exonic
1083891871 11:65599603-65599625 CGCGACCTGCAGCCGCCGGGAGG - Exonic
1084336628 11:68461241-68461263 CGCTCCCCGAGGCCCCCGGGAGG - Intronic
1091402473 12:189267-189289 CGCTGTCTGCGGCCGCCGGGTGG - Intergenic
1099437262 12:82659483-82659505 CGCAGCCCGCGGCCGCCTGGTGG - Intergenic
1114633222 14:24172719-24172741 GGCGACTCGCGGCAGCCGGTTGG + Exonic
1116928655 14:50668214-50668236 CGCTGCTCGGGGACGCCGTGAGG + Exonic
1122888888 14:104723714-104723736 GGCTCTTCGCGGCCGCCAGGGGG + Intergenic
1124627132 15:31314570-31314592 CAGTACTTGCGGCTGCCGGGTGG - Intergenic
1126668443 15:51094781-51094803 CGCTCCCCGCGCCCGCCGGCCGG + Intronic
1129116496 15:73368078-73368100 TGCCACCCGCGGCCGCCGAGGGG + Exonic
1139890655 16:70251542-70251564 CGCTCCTCGCAGCCGCCCGGGGG + Exonic
1142136370 16:88453598-88453620 GGCTAGAGGCGGCCGCCGGGAGG + Exonic
1142136465 16:88453903-88453925 CCCTCCTCCCGGCCTCCGGGCGG - Intronic
1145031523 17:19507958-19507980 CCCGAGTCTCGGCCGCCGGGTGG + Intronic
1147971822 17:44222263-44222285 GGCTGCCCGCCGCCGCCGGGGGG - Intergenic
1152197276 17:78925138-78925160 CGCTGCTCGCGGCGGCGGGCTGG + Exonic
1152635237 17:81428173-81428195 CACTACTAGCGGCCTCCTGGAGG + Intronic
1160822497 19:1065052-1065074 CGCTTCCAGCTGCCGCCGGGAGG + Exonic
1161689017 19:5720046-5720068 CGATGCTGGCCGCCGCCGGGGGG - Exonic
1163210536 19:15836770-15836792 CGGTCCTCTCGGCCGCAGGGTGG - Intergenic
1165745801 19:38229074-38229096 CGGCCCTCGCGGCCGCAGGGTGG - Intronic
1165914152 19:39247723-39247745 AGCTGCTGGCGGCCGCGGGGAGG - Intergenic
1168316370 19:55486473-55486495 CGCTGCTGGCCGCCGCCAGGAGG - Exonic
927215616 2:20666707-20666729 CGCTTCGCGCCGCGGCCGGGTGG - Exonic
929604284 2:43224974-43224996 GGCGACTCGAGGCCGCCCGGGGG + Exonic
931867221 2:66426071-66426093 GGCTTCCAGCGGCCGCCGGGTGG - Intergenic
934655904 2:96116740-96116762 CCCGAGGCGCGGCCGCCGGGAGG - Intergenic
935790011 2:106582258-106582280 CGCTGCTCGCGGCCGGCAGGAGG + Intergenic
938496797 2:131801994-131802016 CGCTTCGCGCTGCCGCCGGCTGG - Intergenic
942890529 2:180981148-180981170 CGCTACCCGCGGCCCCCGCGCGG + Intronic
948892540 2:240914528-240914550 CGCTCCTCGCGGCCACACGGGGG + Intergenic
1168777855 20:462584-462606 CGCTACGCCCGGCCGGCGGCGGG + Intergenic
1169208268 20:3752044-3752066 CGGATCTCGCGGCGGCCGGGAGG - Exonic
1173243489 20:41317806-41317828 CGCCTCTGGCGGCCGCGGGGCGG + Intergenic
1174597290 20:51693998-51694020 AGCTACTCACGGCGGCCGTGGGG + Exonic
953947880 3:47164392-47164414 CGCTGCCCCCGGCCGCCAGGCGG - Intergenic
961182462 3:124887294-124887316 CCCAAGTCGCGGCCGCCGAGCGG - Exonic
964438185 3:156675296-156675318 CGCTTCCCGCGGCGGCGGGGAGG - Exonic
966886273 3:184379745-184379767 CGCTGCTGGCGGCCACAGGGCGG - Intronic
969715736 4:8867389-8867411 CGCTCCTCGCTGAGGCCGGGGGG + Exonic
978529953 4:109703109-109703131 CGCTACTCGGGACCGCCAGGAGG + Intronic
985784531 5:1886968-1886990 GGCTCCGCGCGGCCGCCGAGGGG - Exonic
998583487 5:143403755-143403777 CGTTCCCCGCGGCCGCCGCGCGG - Intronic
1001576163 5:172765333-172765355 CCCTCCCCGCGCCCGCCGGGTGG - Intergenic
1003545074 6:7052069-7052091 GGCTCCTCGCGGGCGCAGGGTGG - Intergenic
1008673310 6:53794960-53794982 TCCTACTCGCAGCCGCCGCGCGG - Exonic
1008952145 6:57172637-57172659 CTCCACTCGCTGCCGCCGGAGGG + Exonic
1012472943 6:99590978-99591000 AGCTGCTGGCGCCCGCCGGGAGG + Intergenic
1014724921 6:124962474-124962496 CGCTGCCCGCGGGCGCCGGGTGG + Intergenic
1020204529 7:6104868-6104890 CGCCCCTCCGGGCCGCCGGGGGG - Exonic
1021451179 7:20785046-20785068 CGCTGCACCCTGCCGCCGGGGGG - Exonic
1027202653 7:76073236-76073258 GGCTTGTCGAGGCCGCCGGGAGG + Intergenic
1053010308 9:34629063-34629085 CGCTGCTTGCGGCGGCCGCGGGG + Intergenic
1060695690 9:125707149-125707171 TGCTGCTCGCCGCCGCCGGCCGG + Exonic
1060811059 9:126611770-126611792 CGCGGCTCGGGGCCGGCGGGCGG - Intergenic
1062656249 9:137605659-137605681 CGGGACTCGCGGGCGGCGGGCGG + Exonic
1186705889 X:12138775-12138797 CGCAGCTCGCGGCCGGAGGGGGG + Exonic
1187507262 X:19887748-19887770 GGGGACGCGCGGCCGCCGGGCGG + Intergenic
1198683385 X:139204470-139204492 CGCTCCTCTCGGCCGCCCCGGGG - Intronic
1199942219 X:152637925-152637947 CGCACCTCGCAGCTGCCGGGCGG + Intergenic