ID: 1077979022

View in Genome Browser
Species Human (GRCh38)
Location 11:7279961-7279983
Sequence ACCTTAGGTGAAGAGCAATG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 122
Summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 110}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077979022 Original CRISPR ACCTTAGGTGAAGAGCAATG AGG Intronic
901814077 1:11784248-11784270 GCCTGAGGAGAAGAGCACTGGGG + Exonic
902622749 1:17659970-17659992 AACTGAGGCCAAGAGCAATGTGG + Intronic
902682133 1:18050924-18050946 AACTGAGGTCAAGAGCAAAGTGG + Intergenic
902766156 1:18616842-18616864 ACCTTGGGTTAGGAGCAATTAGG + Intergenic
903678540 1:25082062-25082084 GCCTTAGGTACAGAGGAATGAGG + Intergenic
911096113 1:94056486-94056508 ACCTTAGGTCAAAGGCAAAGTGG + Intronic
912404114 1:109422367-109422389 ACGTTAGGTGAAAGGTAATGAGG - Intronic
917185229 1:172346431-172346453 ACTTTATCTGAAGAGCACTGTGG + Intronic
920142107 1:203823946-203823968 ACCTAAGGTGAAGAGCAAGGTGG + Intronic
922126004 1:222724477-222724499 AACTTCTGTGGAGAGCAATGAGG - Intronic
924601300 1:245491987-245492009 AACTGAGGTGAAGAGAAATTTGG - Intronic
1064349760 10:14566265-14566287 ACAGTAGGTGGAGAGGAATGTGG - Intronic
1064816574 10:19271899-19271921 ACCTTGAGAGATGAGCAATGAGG + Intronic
1065383350 10:25111447-25111469 ACCTAGGCTGAAGAGCAGTGGGG - Intergenic
1069281798 10:66663517-66663539 AGCCTAGGTGAAAAGCAAAGTGG - Intronic
1071112775 10:82180322-82180344 ACCTTAGGGGAAAAGCATTCAGG + Intronic
1073320810 10:102615382-102615404 ACCTTAGGCAGAGAGGAATGAGG - Exonic
1075623269 10:123943582-123943604 CCCTGAAGTGCAGAGCAATGAGG + Intergenic
1077827168 11:5823658-5823680 CTCTCAGATGAAGAGCAATGTGG - Intronic
1077979022 11:7279961-7279983 ACCTTAGGTGAAGAGCAATGAGG + Intronic
1084121799 11:67073505-67073527 TGCTTAGGGGAAGAGCAATCAGG + Intergenic
1084157242 11:67320689-67320711 AACTAAGGTGAAGAACCATGAGG + Intronic
1085421472 11:76365318-76365340 ACCTTGGGTGAGTAGAAATGGGG + Intronic
1085706675 11:78792585-78792607 ACCTGATGGGAAGATCAATGTGG + Intronic
1086535319 11:87837322-87837344 TCCTTATGTAAAGAACAATGTGG + Intergenic
1087176439 11:95100336-95100358 TCCTTATCTGAAGAGCACTGGGG - Intronic
1088225402 11:107614703-107614725 ACCTTATCTGAAGAGCAATAAGG - Intronic
1088569517 11:111208661-111208683 ACCTTAGGTCAATATCAATTAGG + Intergenic
1089553584 11:119301153-119301175 ACCTCAGGTGAAGAGGAAAAGGG - Exonic
1090984032 11:131750070-131750092 ACCTTAGGTGGAAAGCCATTAGG + Intronic
1092596610 12:10012622-10012644 ACCTAATATGAAGTGCAATGAGG - Intronic
1093282387 12:17210327-17210349 TCCTTAGGTGAAGAGAAAGATGG - Intergenic
1097632062 12:62076551-62076573 ACCTTAGCAGAAGAGGAATTTGG - Intronic
1098741854 12:74182503-74182525 ACATGAAGTTAAGAGCAATGAGG - Intergenic
1099877002 12:88419893-88419915 TCCTTAGCTGAAGATGAATGAGG - Intergenic
1100861421 12:98811071-98811093 ACGTTAGCTGAAAAGCAGTGCGG - Intronic
1104247013 12:127053291-127053313 ACCATAGGTGAAAAGCCATTTGG + Intergenic
1114861319 14:26527029-26527051 ACCTAAGGTAAAGTCCAATGAGG + Intronic
1118505113 14:66402800-66402822 GCCTTAGGTCCAGAGCAGTGGGG - Intergenic
1118771040 14:68942970-68942992 ACCTCAGGTGAAGAGAATTGAGG - Intronic
1124269339 15:28266471-28266493 ACCCAAGGTGGAGTGCAATGGGG - Intronic
1128767129 15:70258066-70258088 ACCTGAAATGTAGAGCAATGAGG - Intergenic
1130731573 15:86498888-86498910 TCCTTAGGAGAAGAGTAATACGG - Intronic
1143652071 17:8269288-8269310 CACTTAGGTGAAAAGCCATGGGG - Exonic
1167647400 19:50713179-50713201 CCCTCATGTGAAGAGCAATCAGG + Intronic
1167694976 19:51009855-51009877 GCCTAAGGTGATGAGGAATGAGG - Intergenic
1168450786 19:56465015-56465037 ACATTTGGTGAAGAGTAATTAGG - Intronic
924995944 2:361034-361056 ACTTTATGTGTAGTGCAATGTGG - Intergenic
930232612 2:48858181-48858203 ACCCTTGGTGATGAGCAAGGAGG - Intergenic
934305128 2:91815460-91815482 ACCTTAGGGGAAGACCATTGTGG - Intergenic
934328129 2:92037288-92037310 ACCTTAGGGGAAGACCATTGTGG + Intergenic
936404169 2:112187541-112187563 GCCTTCGGGGAAGAGAAATGAGG - Exonic
940703965 2:157080838-157080860 ACATGAGGTAAAGAGAAATGAGG + Intergenic
942840229 2:180351211-180351233 ACCTTAGGTGAAGTTCTATCAGG - Intergenic
943275436 2:185861535-185861557 AACTCAGGTAAACAGCAATGGGG - Intergenic
944070132 2:195658057-195658079 CCCTTAGGTGGAGAGCGATGTGG + Intronic
945382533 2:209158215-209158237 TCATTTTGTGAAGAGCAATGAGG - Intergenic
948036978 2:234865660-234865682 ACACTAGGAGAAGAGTAATGTGG - Intergenic
1169801759 20:9517985-9518007 ACATTAGGTTAGGAACAATGAGG + Intronic
1170070253 20:12358501-12358523 ACCTTGGGTAAAAGGCAATGTGG + Intergenic
1170105814 20:12753588-12753610 ACCTTATATGAGGAGCAAGGAGG - Intergenic
1174930418 20:54807712-54807734 TCCTTAGATGAAGAAAAATGTGG - Intergenic
1176667822 21:9703968-9703990 CCCTTAAGTGAAGGGGAATGGGG + Intergenic
1178502788 21:33139776-33139798 ACATTTGCTGCAGAGCAATGGGG - Intergenic
1179431863 21:41326885-41326907 AACTTAGGTGAAGGGAAACGAGG - Intronic
1180830399 22:18902941-18902963 ACCTGATGTAAAGAGCCATGGGG + Intergenic
1184044671 22:41965421-41965443 ACCTTTGGTGAACAGCAGTGAGG - Intergenic
1203280488 22_KI270734v1_random:128212-128234 ACCTGATGTAAAGAGCCATGGGG + Intergenic
950606440 3:14085207-14085229 ACCTTAGGTGAGAAGCGATTAGG + Intergenic
950785307 3:15429008-15429030 TCTTTTGGTGAAGGGCAATGTGG + Intronic
951202405 3:19890037-19890059 ATCCTAGCTGAAAAGCAATGCGG + Intronic
955930856 3:64055441-64055463 ATGTTAGTTGAAGAGCAATGAGG - Intergenic
960177946 3:114539463-114539485 ACCTTAGGACATAAGCAATGTGG + Intronic
961668137 3:128506801-128506823 ACCTGAGATGAAGAGGAAGGGGG + Intergenic
963918519 3:150883550-150883572 TCCTTAAGTAAAGAGCAATCCGG - Intronic
966444115 3:179981256-179981278 TCTTTATGTTAAGAGCAATGTGG + Intronic
967203917 3:187101935-187101957 AGCTTGGGGGAGGAGCAATGTGG + Intergenic
971411313 4:26375547-26375569 AACTGAGATGAAGAGGAATGAGG - Intronic
972780344 4:42281770-42281792 ACCTCAGGGGAAGGGCAGTGAGG + Intergenic
975496899 4:75045481-75045503 ACCTTAGTTGAATGGCAATATGG - Intronic
976623323 4:87151560-87151582 ACCTAGGGTGAAGAGAAAGGAGG + Intergenic
980989017 4:139722302-139722324 CCCTTAGGTGAAAAAGAATGTGG - Intronic
981747086 4:148062354-148062376 ATCTTAGGTGAAGAGCACCTGGG + Intronic
985985893 5:3515946-3515968 CCCAGAGGAGAAGAGCAATGAGG + Intergenic
989360707 5:40598269-40598291 TTTTTAGGGGAAGAGCAATGTGG + Intergenic
991358755 5:65798000-65798022 GGATTAGCTGAAGAGCAATGTGG + Intronic
995344280 5:111093504-111093526 AGCTGAGGTGAAGAGCAATTGGG + Intronic
997466036 5:134088748-134088770 ACCTTCAGTGAGGAGCAAGGGGG - Intergenic
997573093 5:134948256-134948278 AACTTAGGTGCAGAGGAATTTGG + Intronic
998126800 5:139629400-139629422 AACTTCTGTGAAGAGCAATGTGG - Intergenic
1001032462 5:168272693-168272715 ATCTTGGGTGAGGAGAAATGAGG - Intergenic
1002488268 5:179554492-179554514 GCCCTAGCTGAAGTGCAATGCGG - Intronic
1003716234 6:8649436-8649458 ACCTTAGGAGAAGAAGAATTGGG - Intergenic
1007165535 6:39826171-39826193 AGCTTAGGAGAAGAGCCCTGGGG + Intronic
1007761488 6:44135978-44136000 ACATTATGCAAAGAGCAATGAGG - Intronic
1011135379 6:84094363-84094385 ACTTTAAGTGAAGAGGAATCAGG - Intergenic
1015670493 6:135684223-135684245 ACCACAGGTGACCAGCAATGTGG + Intergenic
1016462446 6:144291140-144291162 TCTTTATCTGAAGAGCAATGGGG - Intronic
1018474885 6:164130436-164130458 TCCTCAGGTGAAGAGAGATGAGG - Intergenic
1018641045 6:165904296-165904318 GCCTTAGGAGAAGGGAAATGCGG + Intronic
1034217717 7:149421102-149421124 ACCTTACCCTAAGAGCAATGGGG + Intergenic
1036095570 8:5721416-5721438 AATTTAGGTAAAGATCAATGTGG - Intergenic
1037554201 8:20006203-20006225 ACCCAAGCTGAAGAGCAGTGGGG - Intergenic
1037887778 8:22604150-22604172 ACCTCAGGTGAATAGGAAAGGGG + Exonic
1042606726 8:70553318-70553340 ACCTAAGGTCAAGAGGATTGGGG - Intergenic
1044467564 8:92525440-92525462 ACCTTGGGTGCAGGGTAATGTGG - Intergenic
1044542224 8:93420846-93420868 TTCTTAGATGAAGAGTAATGGGG - Intergenic
1048289113 8:133166247-133166269 ACCGTGGGTGAAGAGCAGTTGGG - Intergenic
1052495623 9:29219798-29219820 AGTTTAGGTTAAAAGCAATGTGG - Intergenic
1056811460 9:89768158-89768180 GCCTTAGTTGAAGAGGACTGAGG + Intergenic
1058897719 9:109414479-109414501 CCCTTATGTGAGGAGCCATGTGG - Intronic
1059066931 9:111095288-111095310 ACTTTAGGAGAAGAGCAATGGGG + Intergenic
1203657992 Un_KI270753v1:16731-16753 CCCTTAAGTGAAGGGGAATGGGG - Intergenic
1188066815 X:25671920-25671942 ACCTTAGATGAATAGAAGTGAGG + Intergenic
1188464377 X:30462684-30462706 AGCTTGGGTTAAGAGCTATGAGG - Intergenic
1192099604 X:68250118-68250140 AACATAGGAAAAGAGCAATGAGG - Intronic
1193313080 X:80030569-80030591 AACATAGGTGAAAAGCAAAGTGG - Exonic
1196793579 X:119485358-119485380 ATCTTTGGTGAAGAGGCATGAGG + Intergenic
1198984417 X:142433352-142433374 AGTTTTGGTGAAGAGGAATGTGG - Intergenic
1199899080 X:152155456-152155478 ACTTTATCTGAAGATCAATGAGG - Intergenic
1202302988 Y:23437431-23437453 ACCATAGTTCCAGAGCAATGTGG + Intergenic
1202567823 Y:26233163-26233185 ACCATAGTTCCAGAGCAATGTGG - Intergenic