ID: 1077979326

View in Genome Browser
Species Human (GRCh38)
Location 11:7284354-7284376
Sequence CTCCAACTAATTAAGGAAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 311
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 286}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077979326_1077979328 14 Left 1077979326 11:7284354-7284376 CCTTTTTCCTTAATTAGTTGGAG 0: 1
1: 0
2: 1
3: 23
4: 286
Right 1077979328 11:7284391-7284413 AATTTTTCAAAAGAGAAACATGG 0: 1
1: 1
2: 12
3: 211
4: 1519

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077979326 Original CRISPR CTCCAACTAATTAAGGAAAA AGG (reversed) Intronic
900132625 1:1094055-1094077 CTCCACCCAATTAAACAAAATGG - Intronic
902057648 1:13615591-13615613 CTCCAACTCATATAAGAAAAAGG - Intronic
905985344 1:42276022-42276044 GTCAAAGGAATTAAGGAAAAGGG + Intronic
907789747 1:57650755-57650777 CCCCAACTAATTGAGAAAAGTGG - Intronic
908146592 1:61252600-61252622 CTCCCACTACTTAAAGTAAATGG + Intronic
909855816 1:80529726-80529748 CACCAACTAATTATAGAACATGG + Intergenic
910848120 1:91623488-91623510 CTCAAATTAACTAAAGAAAAAGG + Intergenic
914744891 1:150494401-150494423 AACCAACTAATTCAGGAAAAAGG + Intronic
916178974 1:162067987-162068009 CTCAAACTAATCTAGAAAAAAGG + Intergenic
916370405 1:164087857-164087879 CTCCAAATATTTAATGGAAAGGG - Intergenic
917170159 1:172164151-172164173 CTTAAAGTAATAAAGGAAAAGGG + Intronic
917382986 1:174435527-174435549 CTAAAACAAATCAAGGAAAAAGG - Intronic
917995352 1:180433014-180433036 ATCAAAATAATTAAAGAAAAGGG + Intronic
918731261 1:188000477-188000499 GTACAACTAACTAAAGAAAAGGG + Intergenic
918761053 1:188408363-188408385 CTCAAAGTAAATAAGCAAAAAGG - Intergenic
918791430 1:188835449-188835471 CATCATCTTATTAAGGAAAACGG - Intergenic
919581170 1:199375062-199375084 CACCAAATATCTAAGGAAAAGGG + Intergenic
921712963 1:218391213-218391235 CTGCAAATCATCAAGGAAAATGG - Intronic
922849336 1:228719382-228719404 ATCACACTAATCAAGGAAAAGGG + Intergenic
924182148 1:241449591-241449613 CTTCATCTTATAAAGGAAAATGG - Intergenic
924398964 1:243656919-243656941 ATCCAATAAATTAAGAAAAAAGG + Intronic
1063878029 10:10500159-10500181 CTCCAAATAATAAAGTAAGATGG - Intergenic
1064781808 10:18848434-18848456 CTCCAAAAAATTAAAGAACAAGG + Intergenic
1065224688 10:23531744-23531766 CTCCAACTAGCTGAGGCAAAAGG - Intergenic
1065261285 10:23926163-23926185 CTGAATCTAATTAAGGAACAGGG - Intronic
1067033831 10:42898636-42898658 GTCCAACTAATGATGGGAAAAGG + Intergenic
1068145385 10:53062904-53062926 CTGCCAATAATTAAGGAATAGGG - Intergenic
1069300919 10:66906027-66906049 TTCCAGCTAATAAATGAAAAAGG + Intronic
1069757273 10:70780991-70781013 CTCCAGCTGATTCAGGAAAGTGG + Intronic
1070263160 10:74877334-74877356 ATCAAAATAATTTAGGAAAAGGG + Intronic
1071214921 10:83390076-83390098 TTCCAAAAAATTGAGGAAAAGGG + Intergenic
1071753817 10:88512862-88512884 ATACAACTAATAAAGGAGAAAGG - Intronic
1071989421 10:91086483-91086505 TTCCAAATAATTGAGGAGAAGGG - Intergenic
1072639511 10:97201067-97201089 TTGCAGCTAATTAATGAAAAAGG + Intronic
1073695136 10:105858122-105858144 CTCCAACAAACTAAGGAAGAAGG - Intergenic
1074816443 10:117144908-117144930 CTCCACCTAATTCAGCAAAAGGG - Intergenic
1075708242 10:124515832-124515854 CACCAAATAACTAGGGAAAACGG - Intronic
1076414245 10:130273892-130273914 CTCCAAGGATTTAGGGAAAAAGG - Intergenic
1077879296 11:6335628-6335650 CTTCAACAAATTTAGGAAAATGG - Intergenic
1077979326 11:7284354-7284376 CTCCAACTAATTAAGGAAAAAGG - Intronic
1078273258 11:9817070-9817092 ATGCCACTAACTAAGGAAAAAGG + Intronic
1080092508 11:28365213-28365235 TTCCAAAAAATCAAGGAAAAAGG - Intergenic
1081091736 11:38878250-38878272 CTTCAAAAAATTAATGAAAAAGG + Intergenic
1082191078 11:49245840-49245862 CTCATACTATTTAAGAAAAAAGG - Intergenic
1083496105 11:63055132-63055154 CTCCAAAAAATTGAGGAAGAGGG - Intergenic
1084227034 11:67722957-67722979 ATCCAACAAGCTAAGGAAAAAGG + Intergenic
1085682387 11:78589270-78589292 TTCCAACTAATAAATGCAAAGGG + Intergenic
1086040451 11:82470720-82470742 CTGCAACTTAATAAGTAAAAAGG - Intergenic
1086330952 11:85753609-85753631 ATCCAGCTAATTAAAAAAAAAGG - Intronic
1086675044 11:89595194-89595216 CTCATACTATTTAAGAAAAAAGG + Intergenic
1087177392 11:95108164-95108186 TTTCAACTAATCAAGAAAAAGGG + Intronic
1088560661 11:111112525-111112547 CTCCTACTAAATAATGATAATGG + Intergenic
1088945431 11:114507346-114507368 CTCCAACAAATTGAGGAGGAGGG + Intergenic
1089810358 11:121126382-121126404 CTCCTAATATTTAAGAAAAAGGG - Intronic
1090403932 11:126466237-126466259 TTCCACCTAATTAGAGAAAAAGG + Intronic
1090796385 11:130139066-130139088 CTCCAACTATTTGAGAAAGAGGG - Intronic
1092355725 12:7793651-7793673 AGCCAATTAATGAAGGAAAATGG - Intronic
1092957690 12:13564721-13564743 CTCCAACTGGATAAGAAAAAGGG + Intronic
1093188851 12:16052095-16052117 TTCCAAATAATTAAGGAGGAGGG + Intergenic
1093573104 12:20691942-20691964 TTCCAACTAATAAACAAAAAAGG - Intergenic
1095917669 12:47496443-47496465 TTCTATCTAATTAAGGAGAAAGG + Intergenic
1096915938 12:55033645-55033667 TTCCAACTGAGGAAGGAAAAGGG - Intergenic
1097390061 12:58999570-58999592 GTCCAAGTGATTAAGAAAAAGGG + Intergenic
1098072234 12:66688160-66688182 CTCCAACTAAATTAGCAAAATGG - Intronic
1098740322 12:74165856-74165878 TTCCAACAAATTAAGGAGGAAGG + Intergenic
1099455016 12:82852738-82852760 CTCCAGCAAAATAAGAAAAAGGG - Intronic
1099859951 12:88214111-88214133 TTCCAAAAAATTAAGGAGAAAGG + Intergenic
1100732763 12:97490972-97490994 GTCCAAGTGATTAGGGAAAATGG + Intergenic
1102956159 12:117060451-117060473 CTCCCACTAATGAGGAAAAAGGG - Intronic
1104394046 12:128416063-128416085 CACCACCTAATTAAAAAAAAGGG - Intronic
1106040762 13:26089432-26089454 CTCAAACTAATTAAGGGCATTGG - Intergenic
1106099192 13:26679857-26679879 CTTCAATTAAGGAAGGAAAAAGG + Intronic
1107396564 13:40024135-40024157 TTCCAAGGAATTAATGAAAATGG - Intergenic
1109598770 13:64594887-64594909 CTCCAAAAAATTAAGAAGAAGGG - Intergenic
1109832521 13:67810856-67810878 CTCCAACTACTTCAAGACAATGG + Intergenic
1110384047 13:74887906-74887928 CTCCAGCCAATTAAGCATAATGG + Intergenic
1110882667 13:80591538-80591560 CTCCAAATAAATAAGCTAAAAGG - Intergenic
1111852662 13:93596461-93596483 CTCCGACTATTTAAGGAGAAGGG + Intronic
1111869893 13:93818495-93818517 CTCCAGCTAATTAATGACCAGGG - Intronic
1115426817 14:33270092-33270114 CTCCATGGAATTAAGGAAAGCGG + Intronic
1115464422 14:33699267-33699289 AACCAACCAATTAAGTAAAAGGG + Intronic
1115926813 14:38445192-38445214 CTCCAAAAAATTGAGGAGAAGGG - Intergenic
1116281961 14:42919607-42919629 CTCCATCTAATGACGAAAAAAGG + Intergenic
1119059021 14:71455344-71455366 GTCCAAATAATTTAAGAAAAGGG - Intronic
1120393456 14:83938012-83938034 CAACAAATACTTAAGGAAAATGG + Intergenic
1120927138 14:89809192-89809214 CCCCAACTCACTAAGGCAAATGG - Intronic
1202889550 14_KI270722v1_random:143123-143145 CTCCAACTCATTAAGCTAAAGGG + Intergenic
1123813904 15:23956975-23956997 CTCTAACAATTTAAAGAAAATGG - Intergenic
1124232286 15:27955905-27955927 CCCAAACCAATTAGGGAAAAGGG + Intronic
1124452495 15:29808749-29808771 CTCCAGCTAACCAATGAAAAAGG + Intronic
1124944801 15:34254625-34254647 TTCAAAATAATTAAGTAAAAAGG + Intronic
1126727025 15:51642183-51642205 TTACAACTAAATCAGGAAAATGG - Intergenic
1126877511 15:53060198-53060220 CTACAACCACTTGAGGAAAAAGG - Intergenic
1127191436 15:56535118-56535140 CTCCTACTTATTAAAAAAAAAGG + Intergenic
1128344220 15:66843204-66843226 CTTAAACTTATTAAGGAAAAAGG + Intergenic
1128655251 15:69456343-69456365 CTACAACTACTTGGGGAAAATGG + Intergenic
1131693455 15:94851083-94851105 TTCCAAAAAATTAAGGAGAAGGG - Intergenic
1131915168 15:97257357-97257379 CTTGAACTGATTAGGGAAAAGGG - Intergenic
1131920598 15:97323865-97323887 CTCATACAAATTAAGAAAAAGGG + Intergenic
1133778609 16:8918800-8918822 CTCCATCTCAATAAAGAAAAAGG + Intronic
1134470384 16:14519840-14519862 TTCCAACTAATAAAAGAAAAAGG + Intronic
1138256142 16:55563332-55563354 TTCCAAATAATTAAAGAAGAGGG + Intronic
1139250788 16:65493459-65493481 CTGTAAGTAATTAAGAAAAAAGG - Intergenic
1139511036 16:67428742-67428764 CTCCACCTAATAAGGGATAAGGG + Intergenic
1140156372 16:72431596-72431618 CACCAATGAAATAAGGAAAAAGG - Intergenic
1143818503 17:9540250-9540272 CTCCAACTAGTCAGGGAAGATGG - Intronic
1144157164 17:12516838-12516860 CTCAAAGTAATTAAAGAATAAGG + Intergenic
1144997317 17:19279174-19279196 CTCCAAACAATTAAGAAACAGGG - Intronic
1147397521 17:40156231-40156253 CTTCATGTAATTAAGGGAAATGG + Intronic
1149415364 17:56454192-56454214 CTCCAAGAAAGTAAGGCAAAAGG - Intronic
1153061433 18:999103-999125 TTTGAAATAATTAAGGAAAAGGG - Intergenic
1153277892 18:3385987-3386009 ATCCAACTAATAAACAAAAAGGG - Intergenic
1153343224 18:3998156-3998178 CTCCATCTAATAAATGAAGAAGG - Intronic
1155179420 18:23331149-23331171 CTGTGACTAATTATGGAAAACGG - Intronic
1155347157 18:24868887-24868909 CTCAAACTAATAAAGTAAACGGG - Intergenic
1155849993 18:30762080-30762102 GTCCACCCAATTAAGGCAAATGG - Intergenic
1156806388 18:41187948-41187970 CTCCAAAGAAATAAGAAAAATGG - Intergenic
1157371069 18:47112425-47112447 CTCAAATAAATTTAGGAAAAAGG - Intronic
1157912933 18:51636345-51636367 CTCCAACTCACTAAGCTAAAGGG + Intergenic
1159512066 18:69407798-69407820 TTGCAAATAATTCAGGAAAATGG - Intronic
1159848309 18:73493785-73493807 CTAACTCTAATTAAGGAAAAAGG - Intergenic
1160440563 18:78887525-78887547 TTCCAAAAAATCAAGGAAAAAGG + Intergenic
1164274812 19:23707042-23707064 CTCCAATTAATAAATGAAAATGG - Intergenic
1164508013 19:28875192-28875214 CTCCAGCTATTTCAAGAAAAGGG - Intergenic
1165025173 19:32955369-32955391 CCCCACCTAAGCAAGGAAAATGG - Intronic
1167537939 19:50067209-50067231 CTCCATCTAAAAAAGAAAAAAGG - Intergenic
1167920536 19:52779612-52779634 CCCCAACTCACTAAGCAAAAGGG + Intronic
1202664955 1_KI270708v1_random:109892-109914 CTGCAACTCATTAAGCTAAAGGG + Intergenic
925090828 2:1154724-1154746 TTCCCCCTATTTAAGGAAAATGG + Intronic
925362866 2:3291810-3291832 CTCCAAGAAAATCAGGAAAACGG - Intronic
926517763 2:13870724-13870746 TTACAACTAATAAAGGGAAATGG + Intergenic
926854379 2:17237506-17237528 TCCAAACTAATAAAGGAAAAGGG + Intergenic
928470458 2:31569984-31570006 CTCCAAAAAATTGAGGAAGAGGG + Intronic
929088835 2:38194771-38194793 CTCCTCCTCATGAAGGAAAATGG - Intergenic
929907430 2:46058449-46058471 CTTCAACTAAAGAAGAAAAAGGG + Intronic
930244102 2:48965557-48965579 CTGCAACTAATTCAGTAACAGGG - Intronic
930648121 2:53933853-53933875 CTCCTACTGATTAAGAAAAATGG + Intronic
931326010 2:61224173-61224195 TTTCAACTAATTATGGCAAAAGG - Intronic
931350898 2:61487723-61487745 CTGCAAATCATTTAGGAAAAAGG + Intronic
931705190 2:64941318-64941340 CTCCACCTAATGGAGGAACATGG - Intergenic
932628135 2:73315119-73315141 CACAAATTAATAAAGGAAAATGG - Intergenic
932762232 2:74445869-74445891 CTCCAACTGACTAATGGAAAAGG - Intergenic
933621443 2:84547001-84547023 TTCCAGCTATTTAAGGAATAAGG - Intronic
936714082 2:115163406-115163428 CTCCCACTAATAAACGAGAAGGG - Intronic
939037878 2:137154803-137154825 CACCATGTCATTAAGGAAAATGG + Intronic
940357719 2:152763753-152763775 CACCATCTGACTAAGGAAAAGGG + Intergenic
940831184 2:158467919-158467941 CTCCAAAGAATTATGCAAAATGG - Intronic
941715876 2:168762870-168762892 CTCAAAAAAATAAAGGAAAAAGG - Intronic
941802581 2:169676761-169676783 CTGCAACAAAGTAAGGAAACAGG + Intronic
942029892 2:171949115-171949137 GCCCAACTAATAAATGAAAAAGG - Intronic
943346303 2:186741495-186741517 CCCTAACTAAATAAGGTAAATGG + Intronic
943521092 2:188949928-188949950 CTCCTAGTAGTTAAGGACAAAGG - Intergenic
944219399 2:197287311-197287333 CTCCAACTGATTAAAAAAAATGG + Intronic
944241023 2:197485182-197485204 CTCAAGCTAAGAAAGGAAAACGG - Intergenic
946768705 2:223064806-223064828 CTCCAACTTGTAAAGGAAAGTGG + Intronic
948967031 2:241390578-241390600 ATCCAACTAAATAATGAAAAGGG - Intronic
1169337811 20:4771496-4771518 CCCCAACTCACTAAGGCAAAGGG - Intergenic
1169379406 20:5093958-5093980 CTCCATCTCACAAAGGAAAAAGG - Intronic
1169617639 20:7467664-7467686 GTCAGACTAACTAAGGAAAAGGG - Intergenic
1170389068 20:15852250-15852272 CTTCAACTCAATAAGAAAAATGG - Intronic
1170496064 20:16926735-16926757 CTCCAACCAATTAAAGTTAAGGG - Intergenic
1171298615 20:24040137-24040159 CTCCAAGGAATAAAGGAAAACGG - Intergenic
1174928801 20:54790646-54790668 TTCCAAGTAATTGAGGAGAAGGG - Intergenic
1175019842 20:55833957-55833979 CTCAAAATAATGAAAGAAAAAGG + Intergenic
1176897768 21:14402902-14402924 CTTGAATTATTTAAGGAAAAGGG + Intergenic
1178047623 21:28713023-28713045 CTGCAAGTAAATAAGGACAAAGG + Intergenic
1178234579 21:30825966-30825988 TGCCAACTAATAAAGGTAAAGGG + Intergenic
1179965262 21:44801247-44801269 TTCCCTCTAATGAAGGAAAAGGG - Intronic
1180246991 21:46554964-46554986 CTACAACAAAGAAAGGAAAAGGG - Intronic
1180331680 22:11486812-11486834 CTCCAACTCATTAAGCTAAAGGG + Intergenic
951299888 3:20983356-20983378 TTCCAGCTAATAAATGAAAATGG + Intergenic
952361565 3:32635481-32635503 CTCCAACTCATTATGAAAAGTGG - Intergenic
953467373 3:43134450-43134472 TTCCAACTAATAAAGGCAGATGG + Intergenic
958082497 3:88764455-88764477 TTCCAAAAAATTGAGGAAAAGGG - Intergenic
958194266 3:90222229-90222251 CTCGAATTAATTAAAGAGAAGGG + Intergenic
960015358 3:112881773-112881795 TTCCAAAAAATTGAGGAAAAGGG - Intergenic
960295010 3:115932247-115932269 CTCCAAATCATTAAGAAAATGGG + Intronic
960882364 3:122357956-122357978 CCTCAACTAATGAAGGAAGATGG - Intergenic
962068242 3:132006156-132006178 CTCCTTCTATTTAAGGAAAGTGG + Intronic
962523514 3:136218340-136218362 CTCCAACTTAAAAAAGAAAAAGG - Intergenic
962557446 3:136569511-136569533 TTTCAACTAATTAAAGAACAAGG + Intronic
963860289 3:150302641-150302663 CTCCATCTAATTAAGAGAACAGG - Intergenic
964131366 3:153291288-153291310 CTTCAATCAATTAAGAAAAAGGG + Intergenic
965166671 3:165202941-165202963 ATCCAACTAGTTTAAGAAAAGGG + Intergenic
966977771 3:185101139-185101161 TTCCAATAAATTAAGGAAGAAGG + Intronic
968424616 4:514197-514219 TTCCAAATAATAAAGGAGAAGGG - Intronic
971045517 4:22801264-22801286 TTCAAAGTAATTAAGAAAAATGG - Intergenic
971711946 4:30124311-30124333 CTCAAACTAATCCAGGAAGAGGG - Intergenic
972277361 4:37569560-37569582 CTCAAACTAATTAAGCTATATGG - Intronic
972625066 4:40789008-40789030 TTCCAGCTAATAAAGGAAAAAGG + Intronic
973116738 4:46470017-46470039 CTGCAACAAATTAAGTAAAAAGG + Intronic
973298060 4:48548900-48548922 ATACAACTTATCAAGGAAAAAGG + Intronic
974094585 4:57349473-57349495 TTCCAAAAAATTAAGGAGAATGG - Intergenic
974745146 4:66063097-66063119 CCCCAACTGGTTAGGGAAAATGG + Intergenic
974856340 4:67465869-67465891 CTCCCACTACTGAAGGAAAGGGG + Intergenic
975019864 4:69473486-69473508 CTATAACTTATGAAGGAAAAAGG + Intergenic
977308341 4:95353097-95353119 CTCAAAGTCATTAAGGAATAAGG - Intronic
977422702 4:96823057-96823079 CTACAACTAATGTAGGAAATTGG - Intergenic
977744275 4:100526755-100526777 CTCTAACTCTTGAAGGAAAATGG + Intronic
979590653 4:122476038-122476060 CACCAACAAATGATGGAAAAAGG - Intergenic
980141225 4:128920003-128920025 CTCCAAAAAATTGAGGAGAAGGG + Intronic
981157853 4:141461069-141461091 TTCCAACTAATAAATTAAAAAGG - Intergenic
981310690 4:143295182-143295204 CTCCAATTAACTATAGAAAAGGG + Intergenic
981947123 4:150360894-150360916 CTCTAAATAATAAAGGTAAAAGG + Intronic
982446541 4:155497305-155497327 CTCCATCTAATGAATGGAAATGG - Intergenic
982751331 4:159166017-159166039 CTCCAAAGATGTAAGGAAAAGGG + Intronic
984422567 4:179543442-179543464 CTCCAACTCTTTAAGTAAAAGGG - Intergenic
984538494 4:181006787-181006809 CACCAATTAAATAAGGAAACGGG + Intergenic
987587719 5:19877993-19878015 CTCCAAGTCAATAAGGAAAGTGG - Intronic
988018933 5:25598203-25598225 TTCCAAGTAATAAAGGTAAAAGG - Intergenic
989204295 5:38796303-38796325 CTTCAACTTATTAAGTAACATGG + Intergenic
992172006 5:74112202-74112224 CTCTGACTGATTTAGGAAAAGGG + Intergenic
993041446 5:82819266-82819288 ATCCAAATAAGGAAGGAAAATGG - Intergenic
993587959 5:89755701-89755723 GTACAAATAATGAAGGAAAATGG - Intergenic
997796650 5:136817431-136817453 TTCCTACTAATTCAGGGAAAAGG + Intergenic
998646488 5:144067737-144067759 CAACAAATAATTCAGGAAAATGG + Intergenic
1000998972 5:167987331-167987353 CTCCAACTAAAAAAAAAAAAAGG - Intronic
1001200973 5:169716399-169716421 CTCCAAAGAATTCATGAAAAAGG - Intronic
1001977500 5:176012111-176012133 ATGCAATTAATTGAGGAAAAGGG + Intronic
1002239923 5:177831658-177831680 ATGCAATTAATTGAGGAAAAGGG - Intergenic
1003195722 6:3912390-3912412 CTCTAATCAACTAAGGAAAATGG + Intergenic
1004093584 6:12530294-12530316 AGTCAATTAATTAAGGAAAAAGG + Intergenic
1005662920 6:28018693-28018715 CTCTGACTAGTTAAGGAATAGGG - Intergenic
1006249700 6:32771414-32771436 CTCCAACTCATTAAGCCTAAGGG - Intergenic
1007128203 6:39445487-39445509 CTCCAACTAACCATAGAAAAGGG - Intronic
1007382214 6:41497844-41497866 CTCCAACTAGTTTAAGCAAAAGG - Intergenic
1008200244 6:48578477-48578499 CTCCAACTAATAAAAGATGATGG - Intergenic
1008253537 6:49269693-49269715 CTCCAGCTAATGATTGAAAATGG + Intergenic
1008486560 6:52042314-52042336 ATCCAAAGCATTAAGGAAAAGGG + Intronic
1008594236 6:53025205-53025227 CCCCAACTAAATGAGAAAAAGGG - Intronic
1008635953 6:53411278-53411300 TTCTAACTAATAAATGAAAAAGG + Intergenic
1009192376 6:60644850-60644872 CTACATATAAATAAGGAAAAGGG - Intergenic
1009774905 6:68194082-68194104 CTCAAACTCATTAAGCCAAAGGG - Intergenic
1010236447 6:73579025-73579047 CTCCAAGTATTTAAGAAAAGTGG + Intergenic
1010347608 6:74830406-74830428 GTCCAAATAATAATGGAAAAGGG + Intergenic
1011320284 6:86084141-86084163 TTCCAAAGAATTAAGGAGAAAGG - Intergenic
1012750980 6:103163335-103163357 CTCCAACTAAAAAAAAAAAAAGG + Intergenic
1012791521 6:103704073-103704095 CTCCAAGGCAGTAAGGAAAATGG + Intergenic
1013081880 6:106820449-106820471 CTCCTTCTTCTTAAGGAAAAAGG - Intergenic
1013565458 6:111355552-111355574 GTACTAGTAATTAAGGAAAATGG - Intronic
1014000602 6:116361854-116361876 CATCAACTGATTAATGAAAAGGG + Intronic
1016149265 6:140718575-140718597 TTCCAAATAAATAAGGAAGATGG - Intergenic
1016178131 6:141106155-141106177 CTCCAATTAATTAAAAAAATAGG + Intergenic
1017292635 6:152758485-152758507 CTCCATCAAATTAAGAAACACGG + Intronic
1017960630 6:159217753-159217775 CTCCAGCTATTCAAGCAAAAAGG + Intronic
1019332715 7:468594-468616 ATCTCACTAATTAAGGAAATAGG - Intergenic
1020436821 7:8173618-8173640 TTCCAACTAATAAATGAAGAAGG + Intronic
1020447608 7:8285804-8285826 CACCAAAGAATTAAGGGAAAGGG - Intergenic
1021172022 7:17409780-17409802 CTCTGACAAATTAAGAAAAAAGG + Intergenic
1021386172 7:20033651-20033673 CTCCCACTTGTTAAGGGAAAAGG + Intergenic
1022984728 7:35640552-35640574 TTCTAACTTATTAGGGAAAAAGG - Intronic
1024582857 7:50814190-50814212 CTCAAACTCATTCAGCAAAAGGG + Intergenic
1024724683 7:52178911-52178933 CACCAACCAATGAAGGAAACTGG - Intergenic
1026010192 7:66629783-66629805 CTCCAGCTACCTAAGGAACAAGG + Intronic
1026654878 7:72248118-72248140 CTCCATCTAAAAAAGAAAAAAGG - Intronic
1027466472 7:78521539-78521561 CTCCAAGTGCTGAAGGAAAACGG - Exonic
1027668086 7:81064210-81064232 CAGCAAATAATTAATGAAAAGGG + Intergenic
1027931290 7:84538269-84538291 TTCCTACTAATTTAGGATAATGG - Intergenic
1028406838 7:90484712-90484734 CTCAAACTAATTTAATAAAAAGG + Intronic
1029695328 7:102209201-102209223 GTCTAAGTCATTAAGGAAAACGG - Intronic
1030567885 7:111183402-111183424 CTCTGACTAATTATGGAAATTGG + Intronic
1031069807 7:117149727-117149749 CTCCAATTAAAAAAAGAAAAAGG - Intronic
1032691592 7:134293242-134293264 TTCCAGCTAAGTAAAGAAAAGGG + Exonic
1033397228 7:140986660-140986682 TTCCAACTAATTAATGTAGAAGG + Intergenic
1033563534 7:142557156-142557178 ATCCCAATAATTAAGGATAATGG - Intergenic
1034046254 7:147931398-147931420 TTCCAAAAAATTAAAGAAAAGGG + Intronic
1034409153 7:150929707-150929729 TTCCAGCTAATAAATGAAAAAGG + Intergenic
1034885135 7:154793521-154793543 CTCTAGCTAATTAGGGAAATTGG - Intronic
1036108315 8:5868139-5868161 CTCCAAATAATTATAAAAAAGGG + Intergenic
1036214711 8:6869499-6869521 CCCCAACTAATAAATGAAAAAGG - Intergenic
1036902859 8:12684638-12684660 ATCCAACAGGTTAAGGAAAAAGG + Intergenic
1036905278 8:12703550-12703572 ATCCAACAAGCTAAGGAAAAAGG + Intergenic
1039666832 8:39543014-39543036 TTCCAATAAATCAAGGAAAAAGG - Intergenic
1040417161 8:47205843-47205865 CTGCAACTCAGTGAGGAAAAGGG - Intergenic
1041832728 8:62174222-62174244 TTCCAAAAAATTGAGGAAAAGGG - Intergenic
1042740693 8:72041963-72041985 TACTGACTAATTAAGGAAAAAGG + Intronic
1042991989 8:74651750-74651772 CTTCAACTAATTAAGAAATGTGG - Intronic
1044331774 8:90928699-90928721 TTCAAATTAATTCAGGAAAATGG + Intronic
1045239305 8:100384951-100384973 CTCCCACTAAAGAGGGAAAAGGG + Intronic
1045937915 8:107704243-107704265 CTCAAAGCAATTAAGGAAAAAGG + Intergenic
1046505982 8:115138813-115138835 TTCCAAAAAATTAAGGAATAGGG - Intergenic
1047954682 8:129964863-129964885 CTCCAAAGAAATAAAGAAAAAGG + Intronic
1049771801 8:144386009-144386031 CTCCAAAAAATAAAAGAAAAAGG - Intronic
1051817885 9:21131236-21131258 AGCTAACAAATTAAGGAAAAAGG + Intergenic
1052263353 9:26543395-26543417 CTCCAAAAAACTGAGGAAAAAGG + Intergenic
1053279743 9:36812103-36812125 CACCAACTTTTTAGGGAAAATGG - Intergenic
1055683919 9:78749449-78749471 CTTCAAATAATTAAAGAATAGGG - Intergenic
1056237507 9:84609829-84609851 CAACAACTATTTATGGAAAAGGG + Intergenic
1058633775 9:107016952-107016974 CTTCAACTAAGTAAGAAAAATGG - Intergenic
1059263681 9:113005264-113005286 TTGCAACTAATAAAGCAAAAAGG + Intergenic
1059889138 9:118781804-118781826 CTCGAACTAGGTAAGGACAAAGG - Intergenic
1060292855 9:122320172-122320194 TTCCAATTAATTAATGAAAAAGG - Intronic
1061748099 9:132754738-132754760 CTCCAACTACTTAAAGAAAAAGG + Intronic
1062135653 9:134926273-134926295 ATCCAACTACTTCAGGACAATGG - Intergenic
1185534809 X:852570-852592 CTCCAATAACTTATGGAAAAGGG - Intergenic
1186822089 X:13299806-13299828 CTCCAACTAATTAAAAATTACGG + Intergenic
1187189514 X:17020392-17020414 CTCCAGCTCAGTCAGGAAAAAGG - Intronic
1187849738 X:23579952-23579974 ATCCAACCATTTAAGGAAAATGG + Intergenic
1188197751 X:27259416-27259438 CTCAAACTAGTCAAAGAAAAAGG - Intergenic
1189063534 X:37781586-37781608 GTAAAACTAATCAAGGAAAATGG + Intronic
1189873862 X:45413962-45413984 TTCCAAAAAATAAAGGAAAAGGG - Intergenic
1191919480 X:66239252-66239274 CCCCAACAAATTAAGGGGAATGG - Intronic
1192403476 X:70860484-70860506 CACTAAGTAAATAAGGAAAAGGG - Intronic
1192655801 X:72992809-72992831 TTCCAAATAATTGAGGAGAAAGG + Intergenic
1192870864 X:75182391-75182413 TTCCAAAGAATTGAGGAAAAAGG - Intergenic
1195391608 X:104368158-104368180 CTCCTACTATTGGAGGAAAAAGG - Intergenic
1197996771 X:132385199-132385221 TTGCTACTAATTAAGGGAAAGGG + Intronic
1197996993 X:132388032-132388054 CTCCAAATTCTTAAGGAAACAGG + Intronic
1199314905 X:146365511-146365533 GTCTAACTAGTTAAGAAAAAAGG + Intergenic
1199602190 X:149548090-149548112 CTCCAAATAAACAAGGACAATGG + Intronic
1201247991 Y:12025752-12025774 ATCCACCTAATTAAAAAAAATGG - Intergenic