ID: 1077983112

View in Genome Browser
Species Human (GRCh38)
Location 11:7321762-7321784
Sequence GGGCGGGTTAATGCAAATAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 113
Summary {0: 1, 1: 0, 2: 17, 3: 24, 4: 71}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077983105_1077983112 4 Left 1077983105 11:7321735-7321757 CCCACTTCCAATTACATACAAAT 0: 1
1: 2
2: 42
3: 159
4: 525
Right 1077983112 11:7321762-7321784 GGGCGGGTTAATGCAAATAGAGG 0: 1
1: 0
2: 17
3: 24
4: 71
1077983103_1077983112 14 Left 1077983103 11:7321725-7321747 CCCAGTTATACCCACTTCCAATT 0: 1
1: 0
2: 3
3: 22
4: 174
Right 1077983112 11:7321762-7321784 GGGCGGGTTAATGCAAATAGAGG 0: 1
1: 0
2: 17
3: 24
4: 71
1077983104_1077983112 13 Left 1077983104 11:7321726-7321748 CCAGTTATACCCACTTCCAATTA 0: 1
1: 0
2: 1
3: 21
4: 157
Right 1077983112 11:7321762-7321784 GGGCGGGTTAATGCAAATAGAGG 0: 1
1: 0
2: 17
3: 24
4: 71
1077983106_1077983112 3 Left 1077983106 11:7321736-7321758 CCACTTCCAATTACATACAAATT 0: 1
1: 2
2: 37
3: 145
4: 575
Right 1077983112 11:7321762-7321784 GGGCGGGTTAATGCAAATAGAGG 0: 1
1: 0
2: 17
3: 24
4: 71
1077983108_1077983112 -3 Left 1077983108 11:7321742-7321764 CCAATTACATACAAATTAAAGGG 0: 1
1: 0
2: 2
3: 17
4: 206
Right 1077983112 11:7321762-7321784 GGGCGGGTTAATGCAAATAGAGG 0: 1
1: 0
2: 17
3: 24
4: 71

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077983112 Original CRISPR GGGCGGGTTAATGCAAATAG AGG Intronic
902153404 1:14463105-14463127 GGGTGGGTTAATGCAAATTGAGG + Intergenic
902260117 1:15218834-15218856 GGGTGGGTTAATGCAAATTGAGG - Intronic
905764939 1:40592499-40592521 GGGTGGGTTAATGCAAATTGAGG - Intergenic
909051988 1:70777197-70777219 GGGCAGGTTAATGCAAATTGAGG - Intergenic
922968607 1:229715315-229715337 GGACAGGTTAATGCAAATTGAGG - Intergenic
923995896 1:239494090-239494112 AGGCAGGTTAATTCAAATTGAGG + Intronic
924272042 1:242343996-242344018 GGGCTGGTTATTGCAGATAAGGG - Intronic
1063498353 10:6530548-6530570 GGGGGGGTTGTTGCAAATAGAGG + Intronic
1063925783 10:10975946-10975968 GGGTGGGTCAATGGAAATTGAGG + Intergenic
1063966825 10:11352513-11352535 GGCCAGGTTAATGCAAACTGAGG + Intergenic
1064710903 10:18123421-18123443 GAGTGGGTTAATGCAAATGGAGG - Intergenic
1064800469 10:19064954-19064976 GAGCAGATTAATGCAAATTGAGG + Intronic
1065827616 10:29586210-29586232 AGGCTGGTTAATGCAATTTGAGG + Intronic
1065950257 10:30645079-30645101 AGGCTGGTTAATGCAATTTGAGG - Intergenic
1066712627 10:38252134-38252156 GGGCTGGTTATTGCAGATAAGGG + Intergenic
1067488252 10:46672975-46672997 GGGAGGCTTAATGAAAACAGAGG + Intergenic
1067606549 10:47669053-47669075 GGGAGGCTTAATGAAAACAGAGG - Intergenic
1070122123 10:73588030-73588052 GGGAGAGATAATGCATATAGAGG - Intronic
1070129344 10:73646267-73646289 GGGTGGCTTAGTGCAAACAGGGG + Exonic
1076200558 10:128554441-128554463 GGGTGGGTTAATGTAAACTGAGG + Intergenic
1077983112 11:7321762-7321784 GGGCGGGTTAATGCAAATAGAGG + Intronic
1080463195 11:32473562-32473584 GGGCAGGTCAATGCAAACTGAGG - Intergenic
1087959866 11:104334566-104334588 AGGAGGGATAATGCAAATAAAGG + Intergenic
1089624916 11:119745254-119745276 GGGCGGGTTCATGCTGACAGTGG + Intergenic
1094475959 12:30840744-30840766 GGATGGGTCAATGCAAATTGAGG + Intergenic
1096017051 12:48286133-48286155 GGGTGGTTTAATGCAAATTGAGG + Intergenic
1096792703 12:54054822-54054844 GGGAGGGGAAAAGCAAATAGTGG - Intronic
1103879006 12:124151693-124151715 GGGCAGGTTAATGCAAATTGAGG + Intronic
1105796262 13:23856509-23856531 GGGTGGGTTAATGCAAATTGGGG + Intronic
1108376820 13:49821749-49821771 GGGAGGGTTAATGCAAATTGAGG - Intergenic
1110497055 13:76180350-76180372 GGGCAGATTAATGCAAATTGAGG - Intergenic
1111179599 13:84645781-84645803 GGGTGGATCAATGCAAATTGAGG + Intergenic
1112022133 13:95380718-95380740 GAGTGGGTTAATGCAAATTGAGG + Intergenic
1112582487 13:100688435-100688457 GGGCAGATTAATGCACATTGGGG + Intergenic
1112583574 13:100697167-100697189 GAGTGGGTTAATGCAAATTTGGG + Intergenic
1112751485 13:102588329-102588351 GGGTGGGTTAATGCAAACTGAGG + Intergenic
1116259350 14:42602982-42603004 GGGCAGGTTAATGCAAATTGAGG + Intergenic
1121513993 14:94536843-94536865 GGGCAGTTTAGTGCAAATTGAGG + Intergenic
1122797632 14:104213954-104213976 GGGAGGTTTCATGCACATAGAGG - Intergenic
1123854901 15:24398888-24398910 GGGCAGGTCAATGCAAATTGAGG + Intergenic
1123870931 15:24571872-24571894 GGGCAGATCAATGCAAATTGAGG + Intergenic
1126942386 15:53780869-53780891 GGGCACGTTAATGCAAAAGGCGG + Intergenic
1129981172 15:79872616-79872638 GGGCAGGTCAATGCAAATTGAGG + Intronic
1133512583 16:6474053-6474075 GGGCTGGTTACTGCAAACTGTGG + Intronic
1138777434 16:59740914-59740936 GGGAAGGTTAATGCAAATTGAGG + Intronic
1142158017 16:88541555-88541577 GGGTGGGTTAATGCAAATTGAGG + Intergenic
1144424856 17:15132285-15132307 GGGTGGGTCAATTCAAATTGAGG - Intergenic
1146087973 17:29847876-29847898 GGGCAGGTTAATGCAAATTGAGG - Intronic
1155523941 18:26697561-26697583 GGGTGGGTCAATGCAATTTGAGG + Intergenic
1159108474 18:64029312-64029334 GAGTGGGTTAATGCAAATTGAGG + Intergenic
1162001767 19:7749111-7749133 GGGTGGGTCAATGCAAATTGAGG - Intergenic
1165134738 19:33660703-33660725 AGGCAGGTTAATGCAAATCAAGG - Intronic
930863709 2:56102497-56102519 GGGTGGGCCAATGCAAATTGAGG - Intergenic
931965433 2:67528671-67528693 GTGCAGGTTAATGCAAATTGAGG - Intergenic
933486888 2:82935445-82935467 GGGTGGGTCAATGCAAATTGAGG - Intergenic
938527605 2:132147924-132147946 GGGCTGTTTAATGAAACTAGGGG + Exonic
940748452 2:157597212-157597234 GGGCAGGTTAATGCACATGCAGG - Intronic
942182642 2:173395168-173395190 GGTCGTGTTAAAGCAACTAGAGG - Intergenic
1169035415 20:2447151-2447173 GGGCAGGTTGATGCAAATTGAGG - Intergenic
1169884856 20:10387991-10388013 GGGAATGTTAATGTAAATAGTGG + Intergenic
1170039037 20:12020727-12020749 GGGTGGATTAATCTAAATAGGGG + Intergenic
1172570708 20:35968166-35968188 GGGCAGGCTAATGCAAATTAAGG + Intronic
1172570712 20:35968188-35968210 GGGCAGGTTAATGCAAATTAAGG + Intronic
1174209902 20:48869470-48869492 GGGTGGGTTAAATCAAATATGGG - Intergenic
1178026796 21:28477635-28477657 GGGTGAGGTAATGCAAATTGAGG - Intergenic
1178042340 21:28653003-28653025 GGGAGGGTTAATGCAAATTGAGG - Intergenic
1183390858 22:37545181-37545203 GGGCGGCTTCATGGAACTAGAGG + Intergenic
951654275 3:24987784-24987806 AGGAGGGTTCATTCAAATAGGGG - Intergenic
952013172 3:28925963-28925985 GAGCAGGTCAATGAAAATAGAGG - Intergenic
955987830 3:64593436-64593458 GGGCTGTTTCATGTAAATAGAGG - Intronic
959770636 3:110090911-110090933 GGGCAAGTCAATGCAAATTGAGG + Intergenic
962488444 3:135867128-135867150 GGGCTGGTTAATAGAGATAGTGG + Intergenic
967012134 3:185445628-185445650 GGGAGTGTTATTGCTAATAGAGG - Intronic
967507817 3:190272936-190272958 GGGCAGGTTGCTGCAAATCGTGG + Intergenic
974836422 4:67256658-67256680 GGGTGGGTCAATGCAAATTAAGG + Intergenic
981176803 4:141691694-141691716 GGGCAGGCTAATGCAAAGGGTGG + Intronic
982109995 4:152045346-152045368 GAAAGGGTTAATGCACATAGGGG - Intergenic
985136653 4:186792982-186793004 GGGCAGGTTAATGCAAATTGAGG + Intergenic
986209495 5:5657345-5657367 GGTGGGGTTATTGCAAATTGAGG - Intergenic
996602998 5:125288668-125288690 GGTGGAATTAATGCAAATAGAGG - Intergenic
997065446 5:130554186-130554208 GGGTGGGTCAATGCAAATTGAGG - Intergenic
998323082 5:141250943-141250965 AGGTGAGTTAATGCAAATTGAGG - Intergenic
1001347082 5:170913342-170913364 GGGTGGGTGAATGCAAATGATGG + Intronic
1003043808 6:2714336-2714358 GGGTGAGTTAATGCAAATTGAGG - Intronic
1004302921 6:14474855-14474877 GGGGGAGTTGATGAAAATAGAGG + Intergenic
1005449627 6:25960301-25960323 GGGCTGGTTCATGCACAGAGTGG - Intergenic
1006199630 6:32276618-32276640 TGGTGGGTTAATGCAAATTGAGG + Intergenic
1009370476 6:62894376-62894398 GTGTGGATTAATGCAAATTGAGG + Intergenic
1010675913 6:78742752-78742774 GGGTGGGTTAATGCAAATTGAGG - Intergenic
1010865954 6:80976978-80977000 GGGCAGGTCAATGCAAATTGAGG - Intergenic
1010866606 6:80983337-80983359 GGGAAGGTCAATGCAAATTGAGG - Intergenic
1011545406 6:88477438-88477460 GGGTGGGTTAATGCAAATCAAGG + Intergenic
1013235933 6:108197970-108197992 GGGAGGTTTAAGGCAAATAAAGG - Intergenic
1014480363 6:121928372-121928394 GGGCTGATTAATGCTAATTGTGG - Intergenic
1016519575 6:144931464-144931486 AGGCAGGTCAATGCAAATTGAGG + Intergenic
1019029090 6:168995046-168995068 GGGCGGGCCAATGCCAATGGAGG + Intergenic
1024747671 7:52427161-52427183 GGGTGGGTTAATGCAAATTGAGG - Intergenic
1026076809 7:67179167-67179189 GGGCAGGCCAATGCAAATAAAGG + Intronic
1026143058 7:67722557-67722579 GGGCAGGTTGAGGCAAATAAGGG - Intergenic
1026700053 7:72633172-72633194 GGGCAGGCCAATGCAAATAAAGG - Intronic
1028317910 7:89427065-89427087 GGGTGGGTCAATGCAAATTGGGG + Intergenic
1030776765 7:113543307-113543329 GGACGAGTCAATGCAAATTGAGG - Intergenic
1043043262 8:75288883-75288905 GGGCTGGTTAATGTAGATAATGG - Intergenic
1055079494 9:72255226-72255248 GGGTGGGTGGATGCAAATTGAGG + Intronic
1189185596 X:39052235-39052257 GGCTGGGTTGCTGCAAATAGAGG + Intergenic
1190554767 X:51623081-51623103 GGGCAGGTCAATGCAAATTGAGG + Intergenic
1190628399 X:52359930-52359952 GGGCGGGTTAATGCAAATTTAGG - Intergenic
1190953319 X:55167455-55167477 GGGCAGGTTAATGCAAGTTGAGG - Intronic
1194152789 X:90345696-90345718 GGGGTGGTCAATGCAAATTGAGG + Intergenic
1195373931 X:104207065-104207087 GGGTGGGTTAATGCAAATTGAGG + Intergenic
1195389221 X:104343689-104343711 GGGCAGGTTAATGCAAATTGAGG + Intergenic
1199561899 X:149172194-149172216 GGGCATGATAATGCAAATGGTGG + Intergenic
1200499133 Y:3922441-3922463 GGGGTGGTCAATGCAAATTGAGG + Intergenic