ID: 1077986232

View in Genome Browser
Species Human (GRCh38)
Location 11:7354100-7354122
Sequence GTGAACATAAAGATGGACAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 239
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 224}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077986232 Original CRISPR GTGAACATAAAGATGGACAC AGG (reversed) Intronic
900091250 1:921733-921755 GTGAACATGGACACGGACACGGG + Intergenic
902687579 1:18088865-18088887 GTAAACAGGAAGATGGACATAGG + Intergenic
904637650 1:31896133-31896155 ATGAACATAAAGATGAGAACAGG + Intergenic
905213517 1:36390833-36390855 GGGAACATCAAGATGAACAAGGG - Intergenic
905502208 1:38448776-38448798 GTGAACACAAAGAAAGACATTGG + Intergenic
908502721 1:64760254-64760276 GAGAACATATAGCTGAACACAGG - Intronic
911726426 1:101246117-101246139 GTGGACATAGAGATGGAAACAGG - Intergenic
917168763 1:172145190-172145212 GTAAACAGAAAGTTGAACACTGG + Intronic
917994146 1:180417491-180417513 GTGAACATAAAAATAGAGCCAGG - Intronic
919611031 1:199745790-199745812 TAGTACATAAAGATGCACACAGG + Intergenic
923432029 1:233932093-233932115 GAGAACACATGGATGGACACAGG + Intronic
924140132 1:241013401-241013423 GTGAACATTCATGTGGACACAGG - Intronic
924658046 1:245991534-245991556 GTCAACTCAAAGATGGACAAAGG + Intronic
1063378741 10:5570851-5570873 GTTAACAAAAAGAGGGACCCTGG + Intergenic
1065378209 10:25063702-25063724 GTGGGAACAAAGATGGACACGGG - Intergenic
1065843754 10:29727939-29727961 GTGAACATAAAGGTTTACTCAGG - Intronic
1066498754 10:35970038-35970060 ATGAACATAAACATGGACACTGG + Intergenic
1068548459 10:58379392-58379414 GCAAGCATAAAGATGCACACTGG - Intergenic
1073521125 10:104130682-104130704 ATGGACATAAAGATGGTAACAGG + Intronic
1074374575 10:112928683-112928705 GAGAACATGAAGATGGTCTCTGG - Intergenic
1074664906 10:115711000-115711022 GTTGACAGAAAAATGGACACTGG + Intronic
1075147802 10:119897382-119897404 GTGAACATCAAGTTGGGCAAAGG + Intronic
1075476934 10:122744123-122744145 GTGGACATAAATATGCAAACTGG - Intergenic
1076623125 10:131805817-131805839 GGGAACGTACAGATGGGCACAGG + Intergenic
1077986232 11:7354100-7354122 GTGAACATAAAGATGGACACAGG - Intronic
1078179435 11:8998582-8998604 GTGATGATAAGGATGGAGACTGG - Intronic
1080560984 11:33462520-33462542 TTGATAATAAAGATAGACACAGG - Intergenic
1084035913 11:66510320-66510342 GTAACCATGAAGATGGAGACAGG + Intronic
1087088374 11:94242840-94242862 CTGAACATAAAAATGGACAATGG + Intergenic
1087608648 11:100407516-100407538 GGGAACACAAAGATAGACAGTGG - Intergenic
1088244861 11:107807874-107807896 CTGAACTTAAAGATATACACAGG - Intronic
1088513761 11:110605169-110605191 AGGAAAGTAAAGATGGACACGGG + Intronic
1089531941 11:119135616-119135638 TAGACCATAAAAATGGACACAGG - Exonic
1090904079 11:131058581-131058603 GTGAACAACAATGTGGACACTGG - Intergenic
1090966422 11:131601209-131601231 GGGAGCATACAGATGGACAGTGG + Intronic
1091163584 11:133449642-133449664 GTGAAGATGAAGATAGAGACTGG - Intronic
1091410716 12:237446-237468 GTGGACATAAAGGTGGAGAATGG + Intronic
1091461822 12:648860-648882 GTGAACAAAAAGCTGGAGGCAGG - Intronic
1092649356 12:10615970-10615992 GTAAACATGAAGATGAACATTGG - Intergenic
1092915542 12:13186010-13186032 GTGCACAGAAGGATGGACACAGG + Intergenic
1097974483 12:65669969-65669991 GTAGACATAAAGATGGGAACAGG + Intergenic
1098084088 12:66822810-66822832 ATGGACATAAGGATGGAAACGGG + Intergenic
1099653610 12:85460956-85460978 TTTAATATGAAGATGGACACAGG - Intergenic
1101618702 12:106362597-106362619 TTGGACATAGAGATGCACACAGG - Intronic
1101751353 12:107585161-107585183 GTTAAAATAAAGATGGTCAGGGG + Intronic
1101803278 12:108041468-108041490 CTGAACATACAAATGGACAGTGG + Intergenic
1102372198 12:112391253-112391275 ATGCATATAAAGATGGGCACTGG - Intergenic
1102878861 12:116468770-116468792 GGAAATAGAAAGATGGACACTGG - Intergenic
1102926173 12:116828131-116828153 GTGAAGGAAAAGATGGTCACTGG - Intronic
1104356623 12:128092456-128092478 CTGAATATAAAAATGGACAATGG + Intergenic
1104394627 12:128421870-128421892 GTGAACAGAGAGATGGAAAAAGG - Intronic
1104400635 12:128473119-128473141 GTGAAGATGAAGATGGAGGCTGG - Intronic
1104400640 12:128473167-128473189 GTGAAGATGAAGATGGAGGCTGG - Intronic
1104400677 12:128473503-128473525 GTGAAGATGAAGATGGAGGCTGG - Intronic
1104400697 12:128473689-128473711 GTGAAGATGAAGATGGAGGCTGG - Intronic
1106100604 13:26692606-26692628 ATGAACATAAAAATGGAGACTGG - Intergenic
1106356006 13:28984016-28984038 CTGAACATAGAGCTGGAAACAGG - Intronic
1106396823 13:29388267-29388289 GGGAAAATAAAGATGGAGTCGGG + Intronic
1106871715 13:34029087-34029109 CTGAATATACAGATGGACAATGG + Intergenic
1107027138 13:35813778-35813800 GTGAACATAAAGAGGTTCAAGGG + Intronic
1108271884 13:48769910-48769932 GTGAAGAACAAGATGGAAACAGG - Intergenic
1108828373 13:54445141-54445163 GTGGACATAAAGATAGACACTGG - Intergenic
1110797559 13:79657751-79657773 GTGAACATGAATATAGACACAGG + Intergenic
1111905354 13:94249385-94249407 GTGAATATAAATTTGGAAACTGG + Intronic
1112368006 13:98772354-98772376 GTAAACAGAAAGTTGGACGCAGG + Intergenic
1113277470 13:108747793-108747815 TTGAATATAAAGATGCAGACAGG + Intronic
1118257262 14:64215884-64215906 GTGAACATCAAGATGGACTTGGG - Intronic
1119373489 14:74168226-74168248 GTGCAATTCAAGATGGACACTGG - Intronic
1120622659 14:86783797-86783819 GTATACATAAAGATGTACATTGG - Intergenic
1123809327 15:23907507-23907529 GTGATCTAAGAGATGGACACAGG + Intergenic
1123823808 15:24060728-24060750 GTGATCCAAAAGATGAACACAGG - Intergenic
1123834694 15:24177559-24177581 GTGATCTAAGAGATGGACACAGG + Intergenic
1123844103 15:24279899-24279921 GTGATCTAAGAGATGGACACAGG + Intergenic
1123870414 15:24566409-24566431 GTGATCTAAGAGATGGACACGGG + Intergenic
1124696445 15:31868378-31868400 GAAAACAAAAAGATGGATACGGG + Intronic
1126467969 15:48977595-48977617 ATGGACATAAAGAAGGAAACAGG - Intergenic
1126599791 15:50417347-50417369 CTGCACAGAATGATGGACACGGG - Intergenic
1128785685 15:70395236-70395258 GGGAACAGACAGAAGGACACAGG + Intergenic
1129964624 15:79723177-79723199 ATGAATAGAAACATGGACACAGG + Intergenic
1131898884 15:97066073-97066095 AGGAGCATAAAGTTGGACACAGG - Intergenic
1133788043 16:8988182-8988204 GTGAAAATGAAGCTGGGCACGGG - Intergenic
1143696904 17:8628195-8628217 GCGAACATAAAGATGGTCTGAGG + Intronic
1143816597 17:9521078-9521100 GTGAATATAAAGATGCACAGAGG + Intronic
1143967978 17:10770573-10770595 GTGAACTTAAAAATTGTCACTGG + Intergenic
1149309822 17:55383085-55383107 GTGAAAATAAAGATAGACTTGGG + Intergenic
1150724417 17:67640037-67640059 GTGAACTTAACGATGTACCCCGG - Intronic
1150948387 17:69773742-69773764 GTGGACATAAGGATGGCAACTGG + Intergenic
1151058766 17:71065775-71065797 GTCAACATAAAGAAGAAAACTGG - Intergenic
1153936581 18:9931440-9931462 ATGAACTTGAAGATTGACACTGG + Intronic
1155685539 18:28544183-28544205 GTGATAATAAAGAAGGATACAGG - Intergenic
1156193797 18:34750274-34750296 GTTTACATAAATCTGGACACTGG + Intronic
1157897835 18:51485396-51485418 ATGAACATAAAGATGAACGGGGG - Intergenic
1158161408 18:54488648-54488670 TTGAATATACAGATGGACAATGG - Intergenic
1158174102 18:54634637-54634659 GAGAACAAACACATGGACACAGG - Intergenic
1159340779 18:67129904-67129926 GCAAACATAAAAATGGACAATGG - Intergenic
1159361430 18:67409173-67409195 GTGAATAGAGAGATGGAAACTGG + Intergenic
1160064634 18:75563281-75563303 GTCAACATAAAGAAGCACGCTGG - Intergenic
1160219269 18:76960741-76960763 GTGCACATGAAGAAGCACACGGG + Exonic
1163290276 19:16374923-16374945 GTGAACATATACATGAATACAGG - Intronic
1166656777 19:44618157-44618179 GGGGACAGGAAGATGGACACTGG - Intronic
1167556100 19:50196650-50196672 ATAAACATACAGATGGACAGAGG - Intronic
925017347 2:541364-541386 ATGGACATGAAGAAGGACACTGG + Intergenic
926592439 2:14753811-14753833 GTTAACTTGAAGATGAACACTGG - Intergenic
926956045 2:18301499-18301521 GTGAAGTCAAACATGGACACCGG - Intronic
927732647 2:25488207-25488229 GTGACTATGAAGATGGACAGTGG + Intronic
928248765 2:29655952-29655974 GTGGATATAAATATGGACACAGG - Intronic
928943907 2:36754827-36754849 GTGTAAATAAAGATGGCGACTGG + Intronic
930281286 2:49373120-49373142 ATGAACATAGAGATGGCAACTGG - Intergenic
932816287 2:74864805-74864827 GTGAACATATAGAAACACACAGG - Intronic
933184742 2:79266649-79266671 GTGAAGATAAAGATAACCACTGG + Intronic
933849898 2:86357688-86357710 GTGAACATAAAGGTGTACAAAGG + Intergenic
936403468 2:112183308-112183330 GTGGACTTACAGGTGGACACAGG - Intronic
936550980 2:113439329-113439351 GTGTAGCTAAAGATGGACAAAGG - Intronic
937192758 2:120120564-120120586 GTGAACATAGACATGTAAACAGG + Intronic
937813198 2:126221587-126221609 CTGAATATACAGATGGACAATGG + Intergenic
938979191 2:136509405-136509427 CAGAATATAAAGCTGGACACAGG + Intergenic
940314902 2:152318522-152318544 GTGAACATAAAGAAAGAGATAGG - Intergenic
940644663 2:156378126-156378148 ATGAACATAAAAATGGCTACAGG - Intergenic
941006638 2:160254363-160254385 GTGAACAGAAACATCCACACAGG + Intronic
1170991925 20:21310663-21310685 TTAAACATAAAGATGCAAACAGG - Intronic
1172151882 20:32796575-32796597 GGGAACATCAAGATGGGCAAGGG - Intronic
1172499926 20:35418467-35418489 GTGAAGAGAAAGATGGGCAGAGG - Intergenic
1173171052 20:40724193-40724215 TTGAACAAACAGATGGACATGGG - Intergenic
1174158635 20:48534433-48534455 GTGAAGATGAAGATGGGGACAGG + Intergenic
1175685810 20:61027922-61027944 GTGAAAATGAGAATGGACACAGG - Intergenic
1178853089 21:36229405-36229427 GTGAACATAAAGGCCGAGACTGG - Intronic
1179010414 21:37552028-37552050 CTGAACATACAAATGGACAATGG + Intergenic
1179623784 21:42635917-42635939 GGGAACAAATAGATGGACAATGG - Intergenic
949340645 3:3026957-3026979 TTGACAATAAAGATGGACTCCGG + Intronic
950852754 3:16078543-16078565 GTGAGCATAAATATGTACATGGG + Intergenic
951766597 3:26206294-26206316 GTGAACAGAAAAATGGAAAGAGG - Intergenic
953450506 3:43001538-43001560 GTGAACATGAAGCTGCAGACAGG + Intronic
956044916 3:65185427-65185449 GTGAACAGAACTATGGATACTGG + Intergenic
956934428 3:74083903-74083925 TTTAACATACATATGGACACAGG + Intergenic
963116760 3:141736916-141736938 AGAAACATAAATATGGACACAGG - Intergenic
963597422 3:147346051-147346073 CTTAACATAAAGATGGAGATGGG + Intergenic
963990337 3:151646076-151646098 GTGAAAATAAAGACTGACCCTGG - Intergenic
964817578 3:160732946-160732968 ATGGACATAAAGATGGCAACTGG + Intergenic
964821401 3:160774288-160774310 GTCTCCATAAAGATGGAGACAGG - Intronic
964882488 3:161439622-161439644 ATGGACTTAAAGATGGAAACAGG + Intergenic
966186585 3:177232486-177232508 GGGAAATTAAAGAGGGACACTGG - Intergenic
966638701 3:182164499-182164521 GTGATCATAAAGCTGGCCAGTGG + Intergenic
967143250 3:186582155-186582177 GTGAACATTAAGATGGAGTAAGG - Intronic
969665698 4:8556229-8556251 GTGACCAGAGAGATGGACGCTGG + Intergenic
970350037 4:15193128-15193150 GTGGACACAAAGCTGGACTCCGG + Intergenic
970886581 4:20993368-20993390 ATGAACAGTAATATGGACACAGG - Intronic
970951840 4:21765569-21765591 TTGAGCTTAAAGATGGACTCTGG + Intronic
972127792 4:35790561-35790583 GTTAAAATAAATATGGCCACTGG + Intergenic
973587917 4:52410837-52410859 GTGAATATATAAATGGACAATGG - Intergenic
973699884 4:53526230-53526252 ATCAACATGAGGATGGACACAGG - Intronic
974833984 4:67224566-67224588 GTGAATATAAAGAAGGAGAGTGG + Intergenic
976514557 4:85950187-85950209 AAGAACATAAAGAAGGCCACTGG + Intronic
976678794 4:87732563-87732585 GTGAACATAAAGGCAGAGACTGG + Intergenic
977957186 4:103043134-103043156 GGGAAAAAAAAGATGAACACTGG + Intronic
978490608 4:109307490-109307512 GGGTATATAAAGATGGCCACAGG - Intergenic
978949496 4:114540483-114540505 ATGAACACAAAAATGGAAACAGG - Intergenic
984042945 4:174759513-174759535 TTGAATATAAAGATGAGCACTGG - Intronic
985193327 4:187401427-187401449 GTGAATAAAAGCATGGACACCGG - Intergenic
985261520 4:188118960-188118982 GTAAACATAATGATAGAAACTGG + Intergenic
985961029 5:3303429-3303451 GTGCTCATTAAGATGGAAACTGG - Intergenic
986144304 5:5063079-5063101 GTGCACATACAGAGGCACACGGG + Intergenic
986211577 5:5678481-5678503 GTGAAGAGAGAAATGGACACAGG + Intergenic
987256512 5:16158898-16158920 GAGAACACATGGATGGACACAGG - Intronic
988022757 5:25644563-25644585 GTGAAAATAAACATCAACACAGG + Intergenic
988275074 5:29069943-29069965 GTGAAAATAAAGATGGGCATTGG + Intergenic
988807224 5:34751494-34751516 ATGCACATAAAGATAGAAACAGG - Intronic
988995281 5:36709101-36709123 TTGAACATAAAGATGTTCAGAGG - Intergenic
989095791 5:37780076-37780098 GTGGAAATAAATATGGATACTGG - Intergenic
989467529 5:41774592-41774614 GTGAGCATAAAAATAAACACAGG + Intronic
989665149 5:43845623-43845645 GTTAACATAAAGATGGCCCATGG - Intergenic
989888287 5:46926658-46926680 GTGAGGCTAAAGATGGAAACGGG + Intergenic
989899356 5:47145621-47145643 GTGAGGCTAAAGATGGAAACGGG + Intergenic
990368270 5:55091719-55091741 GTGAAAATAAAGCTAGACACCGG + Intergenic
991131653 5:63129543-63129565 GTGATCAGAAAGCTGAACACAGG + Intergenic
992752253 5:79872240-79872262 GAGAACACACAGATGGACTCTGG + Intergenic
997338997 5:133127753-133127775 GTAAGCATAAAGATACACACTGG + Intergenic
997444613 5:133932260-133932282 GTCATCAGAAAGATGGAGACAGG - Intergenic
998679442 5:144450163-144450185 GTGACCATACAAATGGCCACCGG + Intronic
998980194 5:147693982-147694004 GTGAAGTTTACGATGGACACTGG + Intronic
998990212 5:147807094-147807116 ATGAACTTGAAGATGGAAACAGG + Intergenic
1000468127 5:161605975-161605997 AGGACAATAAAGATGGACACAGG - Intronic
1004791627 6:19033186-19033208 GTGTACATAAAAATAGATACTGG - Intergenic
1010858871 6:80879338-80879360 GTGTGCATAAAGAAGGACTCTGG + Intergenic
1014096192 6:117464787-117464809 GTGAACATACAGAAGAACAAGGG + Intronic
1015063479 6:128997077-128997099 GAGAACATATGGACGGACACAGG + Intronic
1016185979 6:141197710-141197732 GTGAAGATAGACATGAACACAGG - Intergenic
1016964986 6:149710499-149710521 CTGAATATACAGATGGACAATGG - Intronic
1018322899 6:162632465-162632487 CTGGACATAACAATGGACACTGG + Intronic
1019459972 7:1152684-1152706 GTGAAGATGAAGGTGGAGACGGG + Intronic
1021621837 7:22556707-22556729 GTGAACATGAAGATGGCCATTGG - Intronic
1021726027 7:23548852-23548874 GGCATCATACAGATGGACACTGG + Intergenic
1021896230 7:25238546-25238568 GTGAGCATAACGCTGGAAACAGG - Intergenic
1022243059 7:28531411-28531433 ATGAACATGAAGGTGGAGACTGG - Intronic
1022378505 7:29837765-29837787 ATGAATACAAAGATGGGCACAGG + Intronic
1023735013 7:43227120-43227142 TTTAACATAAAGCAGGACACTGG - Intronic
1024056785 7:45664525-45664547 GAGAACACAAAGATGCACAAGGG + Intronic
1026026418 7:66747944-66747966 GGGAAAATTAAGATGGAAACAGG + Intronic
1029159143 7:98539320-98539342 GTGAACCTAAGAAGGGACACAGG - Intergenic
1031814510 7:126416641-126416663 GAGAAAATAAACATGGACAGGGG + Intergenic
1032197969 7:129800129-129800151 GAAAACATAAAGCTGAACACAGG + Intergenic
1032482802 7:132260467-132260489 GGGAACATAAAGATAAAGACGGG + Intronic
1032607544 7:133372056-133372078 CTGAACTTAAAAATGGACAAAGG - Intronic
1037961594 8:23102319-23102341 GTGGACAGAATGAAGGACACAGG - Intronic
1038101666 8:24384467-24384489 GAGAAGATAAAACTGGACACTGG + Exonic
1038364611 8:26918448-26918470 TTGAAGATAAAGATGGAGAGTGG - Intergenic
1038814334 8:30886046-30886068 GCCAACATCAAGATTGACACAGG - Intronic
1040066339 8:43147707-43147729 ATGAACATAAAGGTGGGAACAGG + Intronic
1041788262 8:61660181-61660203 ATGGGCATAAAGATGGAAACAGG - Intronic
1043541059 8:81263142-81263164 GTTAACATAAACAGGGACAAGGG - Intergenic
1044304958 8:90628373-90628395 CTGACAATAAAGATGGAAACAGG + Intronic
1044542634 8:93424778-93424800 ATCCACATAAAGATGGACTCAGG - Intergenic
1046603125 8:116340884-116340906 ATGAAGCTAAAGATGGACATGGG - Intergenic
1048285569 8:133138630-133138652 GTGAAAATTAAGATGTCCACAGG - Intergenic
1049901954 9:177489-177511 GTGTAGCTAAAGATGGACAAAGG + Intronic
1050891093 9:10825368-10825390 ATGAACACAAAGAAGGAAACTGG - Intergenic
1052081855 9:24215641-24215663 GTAGACATAAAGATGGAATCTGG + Intergenic
1052137213 9:24927618-24927640 GTGGCCATAAATATGTACACAGG + Intergenic
1052248671 9:26370285-26370307 ATGAAAATAAAGCTGGTCACTGG + Intergenic
1052661964 9:31444799-31444821 GAGAACAAACACATGGACACAGG - Intergenic
1053620862 9:39814446-39814468 AAGAACATAAAGATGTACAAGGG - Intergenic
1053744987 9:41187776-41187798 GTGTAGCTAAAGATGGACAAAGG + Intronic
1053884231 9:42629888-42629910 AAGAACATAAAGATGTACAAGGG + Intergenic
1053888437 9:42664406-42664428 AAGAACATAAAGATGTACAAGGG - Intergenic
1054223251 9:62437334-62437356 AAGAACATAAAGATGTACAAGGG + Intergenic
1054227459 9:62471853-62471875 AAGAACATAAAGATGTACAAGGG - Intergenic
1054263300 9:62892996-62893018 AAGAACATAAAGATGTACAAGGG + Intergenic
1054482283 9:65677437-65677459 GTGTAGCTAAAGATGGACAAAGG - Intronic
1054683360 9:68243492-68243514 GTGTAGCTAAAGATGGACAAAGG - Intronic
1055569370 9:77600952-77600974 GTGAAGAAAATGATAGACACAGG + Intronic
1056286415 9:85091852-85091874 GGGAAGAGAAAGATGGAAACAGG + Intergenic
1057446275 9:95117419-95117441 ATGAACATTAAGATTGAAACGGG + Intronic
1057491979 9:95527540-95527562 GTGAAGACAGAGATGGAGACTGG - Intergenic
1058597198 9:106628045-106628067 GTGAACATAAACTTGGTCATTGG - Intergenic
1059035890 9:110753105-110753127 GAGACCATGAAAATGGACACAGG + Intronic
1185929526 X:4186863-4186885 GAGAAGATATAAATGGACACTGG - Intergenic
1189699071 X:43697311-43697333 GGGGACACAATGATGGACACAGG - Intronic
1193523796 X:82563817-82563839 ATGAACACAAAGAAGGAAACAGG + Intergenic
1194831658 X:98631062-98631084 ATAAAGAAAAAGATGGACACAGG + Intergenic
1199138592 X:144283270-144283292 ACGAACAAAAAGATGAACACTGG - Intergenic