ID: 1077988397

View in Genome Browser
Species Human (GRCh38)
Location 11:7378557-7378579
Sequence CAGTTGATGGAGATGGAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 416
Summary {0: 1, 1: 0, 2: 4, 3: 32, 4: 379}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077988390_1077988397 23 Left 1077988390 11:7378511-7378533 CCAAGTACTAAGCTCTAAGAGTT 0: 1
1: 0
2: 2
3: 8
4: 81
Right 1077988397 11:7378557-7378579 CAGTTGATGGAGATGGAAGAGGG 0: 1
1: 0
2: 4
3: 32
4: 379
1077988389_1077988397 24 Left 1077988389 11:7378510-7378532 CCCAAGTACTAAGCTCTAAGAGT 0: 1
1: 0
2: 1
3: 8
4: 113
Right 1077988397 11:7378557-7378579 CAGTTGATGGAGATGGAAGAGGG 0: 1
1: 0
2: 4
3: 32
4: 379

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077988397 Original CRISPR CAGTTGATGGAGATGGAAGA GGG Intronic
901012749 1:6210563-6210585 CAGATGATGGAGTTGGGAGGGGG - Intronic
901417424 1:9127519-9127541 CAGATGCTGCAGATGGAATAGGG - Intronic
901695867 1:11007652-11007674 CAGTTGATGAATCTGGATGAAGG + Intergenic
902722738 1:18314936-18314958 CAGCTGATGGAGGTGCAGGAGGG + Intronic
902882413 1:19381341-19381363 CAGTCGAGGGTGAGGGAAGAAGG - Intronic
903177142 1:21587926-21587948 CCTTTGCTGGAGATGGAAGCTGG - Intergenic
903351429 1:22718974-22718996 ATGTTGATGGAGCTGGAAGCTGG - Intronic
903363561 1:22792368-22792390 CAGTTGAGGGAGAAGGAGGGGGG + Intronic
903485649 1:23688087-23688109 CAGTTGAGGGAGCAGGAAGTGGG - Intergenic
905035130 1:34913120-34913142 CAGAAAATGGAGAAGGAAGAAGG + Intronic
905142823 1:35861934-35861956 CTGTGGCTGGAGAAGGAAGAAGG + Intergenic
905409563 1:37759072-37759094 CAGAAGATGAAGAAGGAAGATGG - Intronic
906077436 1:43062474-43062496 CAGTTGAGGGGCAAGGAAGAAGG + Intergenic
907092973 1:51746269-51746291 AATTTGAGGGAGATGGAATATGG + Intronic
907628643 1:56057544-56057566 AGGATGATCGAGATGGAAGAAGG + Intergenic
907633297 1:56106573-56106595 CAGTTGATGGTGAGGGCAGGTGG + Intergenic
909461222 1:75916684-75916706 CAGAGGGTGGAGATGGAAGAGGG + Intergenic
909694434 1:78450161-78450183 CATTTGACAGAGAAGGAAGATGG - Intronic
910100165 1:83567320-83567342 CATGTGCTGGAGGTGGAAGAGGG + Intergenic
911411860 1:97519848-97519870 CAGCAGATGGAGAAGAAAGATGG - Intronic
911697268 1:100904787-100904809 CAGTTTATGGTGAAGGCAGAGGG + Intronic
913437954 1:118866537-118866559 AAGTGGATGGAGCTGGAAGGAGG - Intergenic
913560931 1:120018747-120018769 CAGTTGTTTGGGATAGAAGATGG - Intronic
913578761 1:120204940-120204962 CTGTTGATGGAAATGTAAAATGG - Intergenic
913629412 1:120693429-120693451 CTGTTGATGGAAATGTAAAATGG + Intergenic
913637197 1:120774855-120774877 CAGTTGTTTGGGATAGAAGATGG + Intergenic
914281515 1:146178159-146178181 CAGTTGTTTGGGATAGAAGATGG - Intronic
914542561 1:148629095-148629117 CAGTTGTTTGGGATAGAAGATGG - Intronic
914624072 1:149442149-149442171 CAGTTGTTTGGGATAGAAGATGG + Intergenic
914716148 1:150256888-150256910 CATGTGATCCAGATGGAAGAGGG - Intergenic
915533302 1:156517074-156517096 CAGATGGTGGAGCTAGAAGATGG - Intergenic
916312103 1:163409086-163409108 CAGATGATGGTGGTGGAATAAGG + Intergenic
916423127 1:164654942-164654964 CATGTGATGGGAATGGAAGATGG + Intronic
917196261 1:172469106-172469128 CTGTTGATGAAAATGGAATATGG + Intergenic
917714276 1:177718438-177718460 AAGTTGAAGGAGACTGAAGAGGG - Intergenic
918094660 1:181324920-181324942 CAGATGCAGGAGATGGAAGGAGG - Intergenic
918104456 1:181404648-181404670 GAGCTGATGGAAATGGAAGAAGG - Intergenic
918105167 1:181410464-181410486 CAGATGCTGGAGATGGAGAAGGG + Intergenic
919090606 1:192974659-192974681 GAGTTGAGAAAGATGGAAGAAGG + Intergenic
919424871 1:197417496-197417518 GAGTTGATAAAGAAGGAAGAAGG + Intronic
920492889 1:206431755-206431777 GAGGGGATGGAGAAGGAAGAGGG + Intronic
920740719 1:208578922-208578944 CAGTGTATGGAGATGGGAAATGG - Intergenic
921095589 1:211884801-211884823 CAGCTGATGGGGAAGGAGGATGG - Intergenic
921585653 1:216943328-216943350 CAGCTGCTGGTGATGGTAGAGGG - Intronic
922552316 1:226504890-226504912 CAGTTTAAGGAGATAGAAGTGGG + Intergenic
922823010 1:228497284-228497306 CAGTGGTTGGACCTGGAAGAGGG - Intergenic
923008294 1:230068504-230068526 GAGTTAATGGAGATGGACTACGG + Intronic
923027685 1:230219049-230219071 CAGATGGTGGAGAGGGGAGATGG - Intronic
923556647 1:235006060-235006082 CCGTGGGTGGAAATGGAAGATGG + Intergenic
1063050033 10:2437068-2437090 CACTTGATGGAGACGGGAGGTGG - Intergenic
1063932457 10:11042925-11042947 CAGTTGATGGACATTTAAGATGG + Intronic
1064715583 10:18173258-18173280 GAGATGATGGAGATGAAATAAGG + Intronic
1064806340 10:19138122-19138144 CTGTTGATGAACATGGCAGAAGG - Intronic
1069171766 10:65239980-65240002 CCTTTGATGGAGATGTAAAATGG + Intergenic
1069649591 10:70035777-70035799 CAGTAGGTGGAGATGGGAGAAGG - Intergenic
1071021514 10:81062597-81062619 CTGTTGATGGAAATGTAAAATGG - Intergenic
1072084132 10:92061703-92061725 CAGGAGATGGAGATGGATAATGG + Intronic
1072788752 10:98302436-98302458 GAGGTTTTGGAGATGGAAGATGG - Intergenic
1073025361 10:100483397-100483419 CAGAGGTTGAAGATGGAAGAGGG + Exonic
1074158068 10:110815517-110815539 AAGTTGCTGGTGATGGATGATGG + Intronic
1074249399 10:111729518-111729540 CATTTGATGAAGATGGAAGTAGG + Intergenic
1074900639 10:117813549-117813571 ACATTGATGGAGATGGAAGTTGG + Intergenic
1075216947 10:120544581-120544603 CACTGGCTGGAGGTGGAAGAGGG - Intronic
1075783121 10:125029979-125030001 AAGTTGATAGAAATGGAAGCTGG - Intronic
1076046361 10:127297177-127297199 CCATTAATGGAGATGGAAGGAGG + Intronic
1076468662 10:130703342-130703364 CAGTTGATGCAGGTGGATGAGGG - Intergenic
1077820686 11:5736927-5736949 CAATTGATGGATAGCGAAGAGGG - Exonic
1077938232 11:6813154-6813176 CAGTGGCTGGAAATGGATGAGGG - Intergenic
1077988397 11:7378557-7378579 CAGTTGATGGAGATGGAAGAGGG + Intronic
1081368731 11:42271706-42271728 CAGTTGGTGCAGATGTAAAATGG + Intergenic
1082797925 11:57391631-57391653 CAGCTGACTGTGATGGAAGATGG + Intronic
1083033076 11:59612247-59612269 CAGGTGCAGGAGATGGAAAATGG - Intronic
1083155149 11:60818278-60818300 CAGGTGATAGAGTTGGCAGAAGG - Intergenic
1083751737 11:64764750-64764772 CACTTCATGGAGAGGGAAGCGGG + Exonic
1084551456 11:69845566-69845588 CAGTCCATGCAGAGGGAAGAAGG + Intergenic
1085440602 11:76559176-76559198 CAGTTGCTGGAAAGGGAAGTGGG + Intergenic
1085568623 11:77539464-77539486 CAGTTTTAAGAGATGGAAGAAGG + Intronic
1086588923 11:88488567-88488589 AAGTTGAAGGAGATGGAAGAAGG - Intergenic
1086607611 11:88715002-88715024 CACTTGATGAAAATGAAAGATGG + Intronic
1087194369 11:95290539-95290561 CTGTTGAAGGAGAGGGAAAATGG + Intergenic
1087970140 11:104470429-104470451 AAGAGGATCGAGATGGAAGAAGG + Intergenic
1088680452 11:112237096-112237118 CAGTGGAAATAGATGGAAGAAGG + Intronic
1088765241 11:112969127-112969149 CATTAGATGGAGCAGGAAGAAGG + Intronic
1088920095 11:114254464-114254486 CAATTGCTGTGGATGGAAGAGGG + Intergenic
1089708828 11:120300437-120300459 TAGCTGATGGAGATGGGAGTGGG - Intronic
1091275011 11:134344188-134344210 TTGTTGATGCAGAGGGAAGAGGG + Intronic
1091515345 12:1174620-1174642 CAGATGATGGAGTAGAAAGAAGG + Intronic
1091752764 12:3032966-3032988 CAGCTGATGGAGGGGGAAGGCGG - Intronic
1092945019 12:13444938-13444960 CTGTTGATGGAAATGCAAAATGG - Intergenic
1094191822 12:27705887-27705909 CAGTTGGTAGAGGTGGGAGATGG - Intergenic
1094496030 12:30989951-30989973 CAGGTGCTGGAGGTGGCAGATGG - Intronic
1095045758 12:37502272-37502294 CAGTTTATGGAGATGAAGCAAGG - Intergenic
1095392590 12:41726768-41726790 CAGAGGATGGAAATGGAAGCTGG + Intergenic
1095706815 12:45245976-45245998 AAGTTGATGGAGATAGCATATGG + Intronic
1095882566 12:47153811-47153833 CAGTTCATGGAGAAGGAAATAGG - Intronic
1097068773 12:56339636-56339658 CAGTGAATGGAGTAGGAAGAGGG + Intronic
1097376621 12:58851128-58851150 CAGTTTATAGACTTGGAAGATGG - Intergenic
1097759956 12:63451985-63452007 CTGTTGATGGAAATGCAAAATGG + Intergenic
1097914738 12:65008844-65008866 CAGATGGTGGAAATGGAAGCTGG - Intergenic
1097949700 12:65414014-65414036 TAGTTGAGGGAGGTGGAGGAGGG + Intronic
1098179612 12:67832259-67832281 CAGGAGAGGCAGATGGAAGATGG + Intergenic
1099535468 12:83838311-83838333 CAGGTGATGGAGATCTAAGCAGG - Intergenic
1099581691 12:84455863-84455885 GAGGAGCTGGAGATGGAAGAAGG - Intergenic
1099657115 12:85507687-85507709 CAGTTGGTTGAGATGGAGTAAGG + Intergenic
1099952453 12:89319418-89319440 CAGTAGATGGAGATCTAATAAGG - Intergenic
1100451406 12:94710570-94710592 CAGCTGAAGAAGATGGGAGATGG - Intergenic
1100841344 12:98614967-98614989 CAGTTGCTGGAGAAGGGAAAAGG + Intronic
1101426263 12:104591057-104591079 CAGTTGTTGGTGTTGGGAGAGGG + Intronic
1101434759 12:104655133-104655155 TAGCTGATGGAAATGGCAGAGGG + Intronic
1101954691 12:109202952-109202974 CAAGTGCTGGAGATGGATGATGG - Intronic
1104654752 12:130565848-130565870 ATTTTGCTGGAGATGGAAGAGGG + Intronic
1105971970 13:25437370-25437392 CAATTGATGGATTTGGAACAAGG + Intronic
1106284433 13:28306628-28306650 CAGTTGATGGAGGGGTACGAGGG - Intronic
1106402028 13:29440644-29440666 CAGATGGTCGAGAGGGAAGATGG - Intronic
1106874879 13:34060687-34060709 CAGTTCAGGGGGAGGGAAGAAGG - Intergenic
1107647773 13:42513101-42513123 TAGCTAATGGTGATGGAAGAAGG + Intergenic
1107985541 13:45772882-45772904 CAATTGTGGGAGATGGTAGAAGG - Intergenic
1108509088 13:51138629-51138651 CTGTTGATGGAAATGCAAAATGG + Intergenic
1109004992 13:56862350-56862372 CAGATGATGCAGAGGGAAGGAGG - Intergenic
1109838225 13:67886772-67886794 CATGAGATGGGGATGGAAGATGG + Intergenic
1110729831 13:78867009-78867031 GAGTTGATGGTGATGGAAGTAGG + Intergenic
1111009564 13:82293588-82293610 AAGTTAATGAAAATGGAAGAAGG + Intergenic
1111181824 13:84679058-84679080 CAATTGCAGGAGATGGAAGGTGG + Intergenic
1112823945 13:103370097-103370119 TAGTTGATTGGGGTGGAAGATGG + Intergenic
1114251752 14:20967884-20967906 TGGTTGATGAAGGTGGAAGAAGG + Intergenic
1115857830 14:37650128-37650150 CAGGTAATGGAAATGCAAGAAGG - Intronic
1115954201 14:38759349-38759371 CATTTGAAGGAGGTGGAGGAGGG + Intergenic
1116277894 14:42860215-42860237 CAGAGGATGCAGAGGGAAGAGGG + Intergenic
1116873860 14:50092356-50092378 CAGTGGGTGGAGATGGACTATGG - Intronic
1117050479 14:51854952-51854974 GAGTAGATGGAGATTGAAGAAGG - Intronic
1118466426 14:66035155-66035177 CAGTTGGTGGATAAGGCAGAGGG + Intergenic
1119190155 14:72676005-72676027 CAATTGAGGGAGAAGGGAGAAGG - Intronic
1121978966 14:98436565-98436587 TAGCTGATGGAAATGCAAGAGGG - Intergenic
1122916321 14:104860657-104860679 TAGTTGGTGGTGATGGAGGATGG - Intergenic
1127395572 15:58541710-58541732 CAGGAGCTGGAGAAGGAAGAAGG + Intronic
1128213920 15:65921394-65921416 CAGCTGATGGATATGGTAGCTGG - Intronic
1129024246 15:72554315-72554337 CTGTTGATGGAAATGTAAAATGG - Intronic
1129301328 15:74627259-74627281 CAGTTGCTGGCATTGGAAGAGGG + Intronic
1129594603 15:76952520-76952542 AAGTTCATGGAGATGGAAGGTGG - Intronic
1131676900 15:94679468-94679490 GAGTTGAAGGAGCTGGAAGACGG + Intergenic
1132354413 15:101160502-101160524 CTATTGCTGGAGATGGAGGAGGG + Intergenic
1134330811 16:13249695-13249717 CAAGTGAAGGAGAAGGAAGAGGG - Intergenic
1134898608 16:17913464-17913486 AAGATGATGGAGAAGGAACATGG + Intergenic
1135628997 16:24021376-24021398 CAGGTGAGAGAGATGGAGGAGGG - Intronic
1135920023 16:26641541-26641563 CAGGGGAGGGAGATGGAGGATGG - Intergenic
1137406888 16:48196279-48196301 CAGGAGGAGGAGATGGAAGAAGG - Exonic
1138650642 16:58459056-58459078 CAGCAGATGGAGATGGGAGGCGG - Intergenic
1138693931 16:58793594-58793616 CAGTTGATGGGGAAGTAAGATGG - Intergenic
1138979955 16:62256042-62256064 CTGAAGATGGAAATGGAAGATGG - Intergenic
1139776849 16:69321774-69321796 CAGAGGATGGAGATGGAGCAGGG + Intronic
1140407607 16:74721486-74721508 CAGGTGAGGGAGATGGAGTAAGG - Intronic
1140916702 16:79500291-79500313 ATGTTGGTGGAGATGGCAGATGG - Intergenic
1145897493 17:28468500-28468522 CTGTTGGTGGAAATGTAAGATGG + Intronic
1145990731 17:29077913-29077935 CAGCTGATGGACCTGGGAGAGGG - Exonic
1146646156 17:34578901-34578923 CTGTTGCTGGGGAAGGAAGACGG - Exonic
1147311240 17:39597218-39597240 CAGTTGATGGTGATGGGGGGCGG - Intergenic
1147865622 17:43550130-43550152 CAGGTGGTGGGGATGAAAGATGG + Intronic
1148761005 17:50000127-50000149 CAGCCCATGGATATGGAAGAGGG - Intergenic
1149632482 17:58138001-58138023 AAGTTGATGGTGTTAGAAGATGG - Intergenic
1149750998 17:59145123-59145145 AAGGTTATGGAGATGGATGATGG + Intronic
1149775183 17:59351638-59351660 CACTTGAAGGAAATGGAAGTGGG - Intronic
1149883371 17:60315479-60315501 CTGTTGATGGAAATGTAAAAGGG + Intronic
1150739150 17:67765656-67765678 CAGATGATGGGGCAGGAAGACGG - Intergenic
1150824037 17:68458455-68458477 CATTTGACGGAGCTGGAAGGTGG + Intergenic
1151052643 17:70995874-70995896 GAGAAGATGGAGAGGGAAGATGG - Intergenic
1151853852 17:76708289-76708311 CAGTTAATGGAAAATGAAGAGGG + Intronic
1152126432 17:78450100-78450122 CTGCAGATGGAGCTGGAAGAGGG - Intronic
1153361878 18:4206761-4206783 AAATTGATGGAGATGAATGAAGG - Intronic
1156673226 18:39496184-39496206 AAGTGGGTAGAGATGGAAGAAGG - Intergenic
1157580736 18:48772533-48772555 GAATTCATGGAGATGGAAGATGG - Intronic
1157681516 18:49611158-49611180 CTGTTGATGGGGATGTAAAATGG + Intergenic
1157716901 18:49894182-49894204 CAGTGGATGGGGATCTAAGAGGG - Intronic
1158249132 18:55467265-55467287 AAGTTCAAGGAGAGGGAAGATGG - Intronic
1159050413 18:63416429-63416451 GAGCAGATGGAGCTGGAAGAGGG - Intronic
1159800415 18:72892064-72892086 CTGTTGGTGGAGATGTAAAATGG - Intergenic
1160492614 18:79350591-79350613 CAGTTGATGGAAATGGTGGTAGG + Intronic
1160676567 19:394319-394341 AAGGTGATGGAGAAGGATGATGG + Intergenic
1160676607 19:394531-394553 GAGAGGATGGAGAAGGAAGATGG + Intergenic
1162380800 19:10330554-10330576 GAGTTACTGGAGATGGAAGGGGG + Intronic
1163498484 19:17661363-17661385 CAGTTGAAGGAGAGAGAAGGAGG + Intronic
1164403805 19:27923867-27923889 CAGTTAATGGACAAGCAAGAAGG + Intergenic
1164491702 19:28720703-28720725 AAGTGGAGGGAGATGGAATAGGG - Intergenic
1164558272 19:29269900-29269922 CGGGTGAGGGAGATGGCAGACGG - Intergenic
1165492400 19:36132053-36132075 CAGATGTTGAAGATGGGAGAGGG + Intergenic
1166422940 19:42652673-42652695 GAGTTGATGAGGATGGAAGGAGG - Intronic
1168471524 19:56644046-56644068 CAGTGAATGGAGGAGGAAGAAGG - Intronic
925887867 2:8409002-8409024 CACATCATGGAGATGGAAGGAGG - Intergenic
925975234 2:9137700-9137722 CATTTGACAGAGATGGAAGGGGG + Intergenic
926313133 2:11688892-11688914 CAGTTAATGGTGAAGCAAGACGG + Intronic
926561341 2:14420635-14420657 CATATGATGGAAATGGAGGAGGG - Intergenic
926813630 2:16779014-16779036 CAGTTGGTGGAAATCGAGGAGGG - Intergenic
927276285 2:21265115-21265137 CAGTGGATGGAGATGAAGGAAGG - Intergenic
927547096 2:23963687-23963709 CTGTTGATGGGGATGCAAAATGG + Intronic
928321616 2:30287915-30287937 CTGAAAATGGAGATGGAAGATGG - Intronic
928620862 2:33086302-33086324 CAGTTAATAGAGTTGCAAGATGG + Intronic
928690157 2:33791191-33791213 CAATTTATGGAGATGGAGGGGGG - Intergenic
932392295 2:71405751-71405773 GAGGTGATGGAGATGTCAGATGG + Intronic
933521340 2:83378547-83378569 CACTTGCTGGAGATGGAGTATGG - Intergenic
933595091 2:84275317-84275339 GTCTTGATGCAGATGGAAGAGGG - Intergenic
934636528 2:95994215-95994237 CAGTGGATGGAATTAGAAGAGGG - Intergenic
936698237 2:114976921-114976943 AAGATGATAGATATGGAAGATGG - Intronic
938019810 2:127896922-127896944 CAGCTGATGGGAATGGAAGACGG + Intergenic
938079544 2:128362457-128362479 CAGTAGATGGAGACGGCAGATGG - Intergenic
939159038 2:138563663-138563685 CTGTTGATGGAAATGTAAAATGG + Intronic
939570414 2:143833651-143833673 CAGTTGGTGGAGGAGGCAGAGGG - Intergenic
941132061 2:161663618-161663640 TAGTTAATGGAGATGGAGGCTGG + Intronic
943566908 2:189526780-189526802 GTGTTGATGGAGAAGGAGGAGGG - Intergenic
944152896 2:196580889-196580911 CAGTTGATGGACAATGAGGATGG - Intronic
944162501 2:196679320-196679342 CAGGGGAAGGAGGTGGAAGAAGG - Intronic
944342389 2:198617372-198617394 CAGTGGGTGGAGATGGGAGGAGG + Intergenic
945141425 2:206690682-206690704 CAGGTGTTGGAGTTGCAAGAGGG + Intronic
948732569 2:239976402-239976424 CAGTTGAGGGAGAAGGAGGATGG - Intronic
1169515812 20:6315432-6315454 GAGTTGATGAAGAACGAAGAAGG + Intergenic
1169571844 20:6914767-6914789 TTGTTGCTGGAGAAGGAAGAGGG + Intergenic
1170773382 20:19353862-19353884 TGGTTGATGGACATGTAAGATGG + Intronic
1172506364 20:35465863-35465885 CAGTTGGTGGAGAAGGCTGATGG + Intronic
1172673997 20:36654524-36654546 CAGTAGGTGGTGGTGGAAGATGG + Intronic
1172896285 20:38302634-38302656 TAGTTGCTGCAGATGGAAGCAGG + Intronic
1172950524 20:38720489-38720511 AGGGAGATGGAGATGGAAGAGGG - Intergenic
1173159173 20:40639606-40639628 CAGATGAATGAGATGGTAGATGG - Intergenic
1173365913 20:42384701-42384723 CTGTTGGTGGAGATGTAAAATGG - Intronic
1173969967 20:47145199-47145221 CAAGTGATGGGGATGGAGGAGGG + Intronic
1174307533 20:49624791-49624813 TAGGTGCTGGAGATGGAACAGGG + Intergenic
1175190195 20:57206610-57206632 CAGGTGATGGAGAAGGGATAAGG + Intronic
1175534627 20:59700190-59700212 CATTTCATGGAGATGGATGTTGG + Intronic
1177639404 21:23827011-23827033 GAGGTGATGGAGAGGGGAGAGGG - Intergenic
1177958122 21:27625978-27626000 CACTTGAAGGAAATGCAAGAAGG + Intergenic
1178390313 21:32192535-32192557 CAGATGATGGAGTTGGAAAGGGG - Intergenic
1178745265 21:35243448-35243470 GAGGAGATGGAGAAGGAAGAGGG - Intronic
1178948159 21:36965641-36965663 CAGAAGATGGAGAGGGAAAAGGG + Intronic
1179130386 21:38631159-38631181 GAGTTGAAGGAATTGGAAGAGGG - Intronic
1180116144 21:45706481-45706503 CAGTAGAGAGAGATGGCAGAGGG - Intronic
1181079139 22:20402203-20402225 CAGTGGAGGGGGATGGAGGAGGG - Intronic
1182936677 22:34229399-34229421 CAGATGAGGGAGCTGGAAGAGGG - Intergenic
1184421449 22:44384901-44384923 GAGTGGGGGGAGATGGAAGAGGG + Intergenic
1184792836 22:46711054-46711076 GACTTGATGGCGATGAAAGACGG + Intronic
950041227 3:9920671-9920693 GAGTGGATGGAGCTAGAAGAGGG - Intronic
951718062 3:25670178-25670200 CAATTGAGGGAGAGGGGAGATGG + Intergenic
952625356 3:35396298-35396320 CAGGTTATGGAAAGGGAAGAGGG + Intergenic
952750873 3:36823919-36823941 CAGTTCATGGATATGTGAGAGGG - Intergenic
952970345 3:38646832-38646854 CACTTGACAGAGAAGGAAGATGG + Intronic
953154837 3:40360315-40360337 CAGATGTTGGGGATGGAAGAGGG + Intergenic
954503851 3:51049410-51049432 CAGTTGAGGGACCTGGAAGTTGG + Intronic
955123714 3:56088152-56088174 CAGATGGTGGAGATACAAGATGG + Intronic
955367003 3:58319359-58319381 TAGTTGGTGGAGATGATAGATGG + Intergenic
956349756 3:68321700-68321722 GAGGTGATGGGGATGGATGAAGG - Intronic
956650513 3:71500575-71500597 CAGATGATGGTAGTGGAAGATGG - Intronic
956815214 3:72902083-72902105 CAGTTGATGGACATTTAAGTTGG + Intronic
957282798 3:78175093-78175115 GAGGTGAAGGAGAGGGAAGAAGG - Intergenic
957440206 3:80236545-80236567 CAGGTTTTGGAGATGGAAAAGGG - Intergenic
957927287 3:86830662-86830684 CAGCTGATGGAGATGGAGAAAGG - Intergenic
959587675 3:108040219-108040241 AAGTTGATGATGATAGAAGATGG - Intergenic
959990569 3:112626923-112626945 AAGTTCATGGAGGTGGAATATGG - Intronic
960898632 3:122532089-122532111 CAGGTGATGAAGCTGGATGAGGG - Intronic
960972669 3:123150706-123150728 CAGTGTCTGGAGAAGGAAGAGGG - Intronic
961197573 3:125015582-125015604 CTATTGATGGGGATGGAAGAGGG + Intronic
961912449 3:130333165-130333187 CAGTTGATGGGAATGTAAAATGG + Intergenic
962400937 3:135058239-135058261 CAGTTGATGAATGTGGCAGAGGG + Intronic
962855020 3:139337144-139337166 ATGTTGATGGAGATGTAAAATGG + Intronic
963936130 3:151055444-151055466 CAGATGATTGGGATGTAAGAAGG - Intergenic
964577415 3:158188480-158188502 CAGATGATAGAGCAGGAAGAGGG - Intronic
964619060 3:158702419-158702441 CAGATGATGGACATGAAAGACGG + Intronic
964762000 3:160143026-160143048 CAGGGGCTGGAGAAGGAAGAGGG + Intergenic
965922632 3:173937068-173937090 AAGCTGAGGGGGATGGAAGAAGG - Intronic
966909274 3:184549704-184549726 CAGTTGTTTAAGATGGAAGCAGG + Intronic
967199750 3:187062225-187062247 CTGTTGATGGGAATGGAAAATGG + Intronic
967325971 3:188240078-188240100 TAGTTCATGGAGCTGGCAGATGG + Intronic
967652048 3:191997881-191997903 AAGTTGAGTGAGATGAAAGATGG - Intergenic
968224451 3:196964930-196964952 AAGTTGGTGGAGCTGGAAGATGG + Intronic
968234706 3:197024732-197024754 CAGCTGCTGGGGAAGGAAGAGGG - Intronic
968781876 4:2588511-2588533 CAGGTGATGGTGATGGATGAGGG + Intronic
969851992 4:9964822-9964844 TTGTTGATGGAGAGGCAAGAGGG - Intronic
970122752 4:12775205-12775227 AAGTAGCTAGAGATGGAAGATGG - Intergenic
970183655 4:13426526-13426548 CAGTTTATGGACATGGAAGGTGG - Intronic
970423570 4:15926829-15926851 CAGTTGTTTGAGCTGGATGACGG + Intergenic
971222217 4:24718734-24718756 CAGTTGAAGCAGAAGCAAGAGGG + Intergenic
972446615 4:39150415-39150437 CAGGGGATGGAGAGGGAGGAAGG + Intergenic
973719564 4:53709546-53709568 CAGTTGATGAAAATGGAGAAAGG - Intronic
973887943 4:55341761-55341783 CAGTTGTAGGAGGTGGAGGAGGG - Intergenic
974144363 4:57928359-57928381 CATTTGTTTGAGATGGAAGTTGG - Intergenic
975712940 4:77178660-77178682 CTGTGGAAGGAGAAGGAAGAGGG + Intronic
978848277 4:113301637-113301659 CAGGTGTTGGAGAAGGAAGGGGG - Intronic
978896519 4:113895103-113895125 CAGTGGTTGCAGATGGAAGTTGG - Intergenic
978943420 4:114465010-114465032 TACTTGTTGGAGTTGGAAGAAGG - Intergenic
979021348 4:115502815-115502837 CAGAAGATGGAGATGGTAGGAGG - Intergenic
979496741 4:121392396-121392418 CCGATCATGGAGATGGATGAGGG + Intergenic
980774067 4:137416489-137416511 TAAGTGATAGAGATGGAAGAAGG - Intergenic
983264992 4:165499277-165499299 GGCTTGATGGAGATTGAAGAAGG + Intergenic
983736246 4:171065483-171065505 CTGTTGATGGGAATGGAAAATGG + Intergenic
986081614 5:4400508-4400530 CATTTGCTGGAGGTGGCAGAGGG - Intergenic
986371795 5:7087655-7087677 CAGTTGGTGGAAAGGGGAGATGG + Intergenic
987551303 5:19385067-19385089 CAGCTGATAGAGCTGGGAGAGGG + Intergenic
987815036 5:22888789-22888811 AAGTTAATGGAGATACAAGATGG + Intergenic
990293439 5:54378368-54378390 CAGTTGATATAGAAGGGAGAGGG + Intergenic
990446126 5:55896386-55896408 CAGCTGAGGCGGATGGAAGAAGG + Exonic
991503183 5:67297921-67297943 CAGCTGATGGAGCTGTGAGAGGG - Intergenic
993204830 5:84865113-84865135 CTGGTGATGGAGAGGGGAGAGGG - Intergenic
993252562 5:85548335-85548357 CACTGCATGGAGATGGATGAGGG - Intergenic
994864299 5:105246048-105246070 CAGTTGAGGGAAATGGAAAAGGG + Intergenic
994902897 5:105799647-105799669 TAGTTGGTGGAGATTGGAGATGG - Intergenic
995706880 5:114995972-114995994 GAGTGGTTGGCGATGGAAGAAGG + Intergenic
995954260 5:117755765-117755787 CAGCTGGTGGATATGGAACAAGG + Intergenic
996101176 5:119447399-119447421 CAGTTGTAGGAGGTGGAGGAGGG - Intergenic
996754363 5:126920596-126920618 TACTTGATGGAACTGGAAGACGG + Intronic
997248571 5:132371482-132371504 CAGTTGTTGGAGCTGGATGTAGG + Intronic
997895649 5:137714228-137714250 CTGTTGATGGAAATGTAAAATGG + Intronic
999587685 5:153109012-153109034 TAGATGGTGGAGATGGTAGAAGG - Intergenic
1000719542 5:164690058-164690080 CTGTTAATGGAAATGTAAGATGG + Intergenic
1000949177 5:167459613-167459635 CTGTTGATGGGTATGGAAAATGG - Intronic
1001251763 5:170152347-170152369 GAGTTCATGGAAATGTAAGATGG + Intergenic
1001791273 5:174459688-174459710 CAGTTCATGGAATTGGAACAGGG - Intergenic
1002430727 5:179202424-179202446 TAGGAGATGGAGAAGGAAGAAGG - Intronic
1002624038 5:180511946-180511968 CTTTTGATGGAAAGGGAAGAAGG - Intronic
1003612066 6:7622676-7622698 CAGATGCTAGAGCTGGAAGAAGG + Intergenic
1003787791 6:9506404-9506426 CTTGTGATGGAGATGGAAAAGGG + Intergenic
1004578379 6:16922523-16922545 CAGTGGCAGGAGATGGGAGAGGG + Intergenic
1004866385 6:19857252-19857274 CAGCTGATGGGGATAGAAGTGGG - Intergenic
1005316105 6:24604268-24604290 CAATGGCTGCAGATGGAAGATGG - Intronic
1005977301 6:30809562-30809584 CAGTTGATGGAGCTGGGCGGTGG + Intergenic
1006102927 6:31697198-31697220 CAGTTGCTGGATTTGGAGGAAGG - Intronic
1007266346 6:40599211-40599233 AACTTGATGGAGAGGGAAGAAGG - Intergenic
1007558258 6:42783727-42783749 CACTTGTTTGTGATGGAAGAAGG + Intronic
1008465750 6:51828925-51828947 CATTTTTTGGAGATAGAAGAGGG + Intronic
1008581707 6:52913980-52914002 CAGTGGAAGGAGATGGGACAAGG + Intergenic
1008966908 6:57322043-57322065 CAGTGGTTGGAGAAGGAAGGTGG + Intronic
1010188943 6:73175056-73175078 CAGGTGAAGGAGATGCAAGCAGG - Intronic
1010737123 6:79455476-79455498 CAGGTGCAGGAGAAGGAAGAGGG + Intergenic
1010899468 6:81408409-81408431 CAGATGATGGAAATGGAAGAAGG - Intergenic
1011526512 6:88271153-88271175 CTTTTGATGGAAATGGAAGTGGG + Intergenic
1011889947 6:92145794-92145816 CACATGATGGAGTTGGAACAGGG + Intergenic
1012175737 6:96080657-96080679 CTGTGGATTGAAATGGAAGAAGG - Intronic
1012362640 6:98402703-98402725 CAGATAATGGAGTTGGAAAATGG - Intergenic
1013277311 6:108598205-108598227 CAATTGAGGGAGATGGAAGAGGG - Intronic
1014696521 6:124628154-124628176 AAGTAGAAGGAGATGTAAGAGGG - Intronic
1014749484 6:125238875-125238897 CAGTTGATGGGCATGTAAGCTGG + Intronic
1014964263 6:127727450-127727472 CAGTTGCTGCAGATGACAGATGG + Intronic
1015011162 6:128350103-128350125 CACTTGATGGGGATGGCAGAAGG + Intronic
1015841220 6:137479280-137479302 GAGTTGAGGGATATAGAAGAGGG + Intergenic
1016883481 6:148934733-148934755 AAGCTGATGGAGTTGGCAGAGGG + Intronic
1017650934 6:156581988-156582010 CAGCTGATAGAGATGGGACATGG + Intergenic
1017870130 6:158479994-158480016 CAGGTGAGGGAGGAGGAAGAGGG - Intronic
1018214678 6:161515161-161515183 CAGTAGATGCAGTTGGAGGAAGG - Intronic
1018352771 6:162978555-162978577 CAGTTGTTGGGGATGGGTGAAGG + Intronic
1018469013 6:164080167-164080189 CAGTTGTTTGGGATGGCAGAGGG + Intergenic
1018748579 6:166781702-166781724 CAGATGATGGAGCTAGGAGACGG + Intronic
1021088566 7:16453139-16453161 CAGATGTTGGAGCTGGAACAAGG - Intergenic
1021986027 7:26099372-26099394 CTTTTGCTGGAGCTGGAAGATGG - Intergenic
1024339169 7:48239559-48239581 CAGTTGATGCACATGGGACAAGG - Intronic
1024569637 7:50713337-50713359 GAAGTGATGGAGATGGAAGGAGG - Intronic
1024782474 7:52867005-52867027 CTGTTTAAGGAGATTGAAGATGG - Intergenic
1025735131 7:64140263-64140285 CAGTTGAAGGATATTGAAGCAGG + Intronic
1025907465 7:65798921-65798943 CATGTGTTGGGGATGGAAGAAGG + Intergenic
1026004635 7:66591569-66591591 CAGTTGAGGGAGAGAGAAGGGGG - Intergenic
1026222845 7:68415414-68415436 AAGACGATGGAGAGGGAAGAGGG + Intergenic
1026435838 7:70396971-70396993 CGGTTGGTGGAAATGTAAGACGG - Intronic
1026527124 7:71163791-71163813 GAGTTGATGCAGATCGAAAAGGG + Intronic
1026621293 7:71952136-71952158 GATTTGATAGAGATGCAAGAAGG - Intronic
1028044709 7:86103563-86103585 TATTTGTTGAAGATGGAAGAGGG - Intergenic
1028762181 7:94509350-94509372 CAGTTGATGGTGCTGGCCGATGG - Intronic
1028990059 7:97039595-97039617 CAGTGGATGGAGCTGGTAGATGG + Intergenic
1029665782 7:101994109-101994131 GAGGGGAGGGAGATGGAAGAAGG - Intronic
1030259752 7:107550651-107550673 CAGGTGATGGGGATGGATGAAGG - Intronic
1032800824 7:135316216-135316238 CAGGTGGTGGAGATGGAGGGGGG - Intergenic
1033759780 7:144426144-144426166 CAGATGAAGGAGCTGTAAGATGG - Intergenic
1034033397 7:147792799-147792821 CTGTTGATGGGGATGTAAAATGG - Intronic
1034187933 7:149193793-149193815 AAGCTGATGAAGATGGAGGAGGG - Intergenic
1034413345 7:150952666-150952688 CTGCTGAAGGAGACGGAAGAAGG - Exonic
1035380489 7:158437185-158437207 CAGATGAGTGAGCTGGAAGAAGG - Intronic
1036777196 8:11621560-11621582 CTGCAGCTGGAGATGGAAGATGG - Intergenic
1037139365 8:15501692-15501714 CATTTGTTGGAGAAGAAAGATGG - Intronic
1038154611 8:24977039-24977061 CTGTTGGTGGAGATGCAAAATGG - Intergenic
1040621987 8:49101611-49101633 CACTTGTAGGAGGTGGAAGAGGG - Intergenic
1040891517 8:52322076-52322098 CTGTTGATTGAAATGGAAGTGGG + Intronic
1041456631 8:58067459-58067481 CAGTGGATGGAGGAGGAAGGAGG - Intronic
1041550108 8:59090955-59090977 CAGCTGGTGGAGATGGCATAGGG - Intronic
1041797321 8:61759253-61759275 CTGTTGATGGAAATATAAGATGG - Intergenic
1042235169 8:66604781-66604803 TAGATGAGGGACATGGAAGAAGG + Intronic
1043166221 8:76906076-76906098 CAGGTGATGGACAAGGAAGTGGG - Intergenic
1044384271 8:91568687-91568709 CGATTGATGCAGATGGAAGAGGG - Intergenic
1044928212 8:97227174-97227196 CTGGGGATGGAGATGGATGATGG - Intergenic
1045981165 8:108189685-108189707 CAGTTTATTGAGAAGGAAGCAGG - Intergenic
1047321798 8:123792987-123793009 AAGTTCATGGGGCTGGAAGAAGG - Intronic
1047444844 8:124910487-124910509 CAGTTGTAGGAGGTGGAGGAGGG - Intergenic
1048612871 8:136042694-136042716 CAGGTGGTAGAGATTGAAGATGG + Intergenic
1048909699 8:139123301-139123323 TAATTGATGGAAAGGGAAGATGG + Intergenic
1050529670 9:6577410-6577432 CAGCTGATGGATATGGGATAAGG - Intronic
1050890011 9:10812761-10812783 AGATTGATGGAGATGGAGGATGG - Intergenic
1052502848 9:29314876-29314898 CAGTTTGTAGAGGTGGAAGAAGG - Intergenic
1053377587 9:37621060-37621082 AAATTGATGGAGAGGGAAGAAGG + Intronic
1053530799 9:38879116-38879138 CAGTTGAGGGAGTTTGCAGATGG - Intergenic
1054203022 9:62103549-62103571 CAGTTGAGGGAGTTTGCAGATGG - Intergenic
1054635341 9:67484816-67484838 CAGTTGAGGGAGTTTGCAGATGG + Intergenic
1056162171 9:83907551-83907573 CATTTGTTGGAAATGGGAGAAGG - Intronic
1056358168 9:85823930-85823952 CATTTGTTGGAAATGGGAGAAGG + Intergenic
1056886819 9:90450805-90450827 CATTTGGTGGAAATAGAAGATGG + Intergenic
1057755986 9:97835944-97835966 CAGTTGAAGGATCAGGAAGAGGG + Intergenic
1058341556 9:103903855-103903877 CAAATGATGTAGATGGAGGATGG - Intergenic
1059257482 9:112944558-112944580 CTGCTGATGGAGATGTAAAATGG + Intergenic
1059375004 9:113875069-113875091 CAGTTGTGGGAGATGTAGGATGG + Intergenic
1061667016 9:132166481-132166503 CAGTGGATGGAAATGGGATAAGG - Exonic
1186245618 X:7613454-7613476 CAGGGGCTGGAGGTGGAAGAAGG - Intergenic
1186380175 X:9049508-9049530 AAGGTGATGAAGAGGGAAGATGG - Intronic
1186543385 X:10423957-10423979 AAGTGGGTGGAGTTGGAAGAAGG - Intergenic
1187469084 X:19552474-19552496 CCAGTGAAGGAGATGGAAGAGGG + Intronic
1189055118 X:37691125-37691147 CAGTTGATGGAAATGAAAGAAGG - Intronic
1189087072 X:38036566-38036588 CAGTTAATGCAGATGGAACAAGG - Intronic
1190236070 X:48616748-48616770 CAGTTGATGTAAAGGGAAGGAGG + Intergenic
1193226245 X:78987647-78987669 ATTTTGATGGAGATGGAAGGAGG - Intergenic
1194992930 X:100564111-100564133 CAGTGGAGGAAGAGGGAAGAGGG + Intergenic
1195633766 X:107089772-107089794 CAGTGGATTGAGGTGGTAGATGG + Intronic
1198206832 X:134473690-134473712 CATTGAAGGGAGATGGAAGAAGG + Intronic
1198654206 X:138895982-138896004 CAGAGGTTGGGGATGGAAGAAGG + Intronic
1199987226 X:152961460-152961482 CAGTTGATGATGGTGAAAGAAGG + Intronic
1200384904 X:155880818-155880840 CAGGGAATAGAGATGGAAGAGGG + Intergenic
1201531014 Y:14989778-14989800 CCATAGATGGAGATGGTAGAGGG - Intergenic
1201906782 Y:19093557-19093579 CAGGAGCTGGAGATGGAGGAGGG - Intergenic