ID: 1077991224

View in Genome Browser
Species Human (GRCh38)
Location 11:7414117-7414139
Sequence CCTTGAGGGCAGAGATTAGA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 278
Summary {0: 1, 1: 1, 2: 2, 3: 21, 4: 253}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077991219_1077991224 25 Left 1077991219 11:7414069-7414091 CCTAGCATGGAAGTAATCTGACA 0: 1
1: 0
2: 1
3: 17
4: 78
Right 1077991224 11:7414117-7414139 CCTTGAGGGCAGAGATTAGACGG 0: 1
1: 1
2: 2
3: 21
4: 253
1077991218_1077991224 30 Left 1077991218 11:7414064-7414086 CCATACCTAGCATGGAAGTAATC 0: 1
1: 0
2: 0
3: 3
4: 61
Right 1077991224 11:7414117-7414139 CCTTGAGGGCAGAGATTAGACGG 0: 1
1: 1
2: 2
3: 21
4: 253

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077991224 Original CRISPR CCTTGAGGGCAGAGATTAGA CGG Intronic
900178991 1:1303131-1303153 CCTTGAGGTCAGAGGTCAGTCGG + Intronic
902096068 1:13947044-13947066 CCATGGGGGCAGAGATCAGAGGG - Intergenic
902466758 1:16623446-16623468 CCCTGAGTTCAGAGATTCGATGG + Intergenic
903744809 1:25579717-25579739 CATTGAAGGCAGAGCTTCGAGGG - Intergenic
906613269 1:47218173-47218195 CCTCGAAGGCAGAGCCTAGAGGG + Exonic
906778025 1:48547508-48547530 GCTTCAGGGGAGAGATTAGGAGG + Intronic
911990216 1:104686657-104686679 ACTTGAGGGCAGAGAGTGGGAGG - Intergenic
912572165 1:110632741-110632763 CCTGGAGGGCAGAAGTAAGAAGG + Intergenic
912611448 1:111049560-111049582 GCTTTGGGGCAGAGATTATAGGG + Intergenic
917046743 1:170869075-170869097 GCTTTAGGGCTGAGATGAGAGGG + Intergenic
917906932 1:179594268-179594290 CAGTGATGGCAAAGATTAGAAGG - Intronic
918431195 1:184462508-184462530 TGTTGAGGGCATAGATTAGGAGG + Intronic
919327433 1:196126436-196126458 ACTTGAGGGTAGAGAGTGGAAGG - Intergenic
919452138 1:197785393-197785415 CCATGAGGGCAGAAACTATATGG - Intergenic
921181403 1:212634545-212634567 CCTTGAGGGAAATGATTAGAAGG + Intergenic
922191457 1:223322578-223322600 CCATGAGGTAGGAGATTAGAAGG + Intronic
922601682 1:226860205-226860227 GATCAAGGGCAGAGATTAGATGG - Intergenic
923551063 1:234963751-234963773 CCTTCAGGTCAGTGAATAGATGG - Intergenic
924702324 1:246466521-246466543 CCTTGAGGGTGGAGGTTGGAAGG + Intronic
1063329542 10:5143362-5143384 CCTAGAGTGCAAAGATCAGAAGG - Intergenic
1069828618 10:71269458-71269480 CCTTGAGGGCAGTGATTAGATGG + Intronic
1071299500 10:84245603-84245625 CATTGAGGGCAGAGAGCTGAAGG - Intronic
1071830998 10:89372050-89372072 ACTTGAGGGTAGAGAGTAGGAGG + Intronic
1074108678 10:110407635-110407657 CTATGAGGGCAGGGATGAGAGGG - Intergenic
1076272763 10:129169187-129169209 CCTTCAAGGCAGAGAATACAGGG + Intergenic
1077095255 11:796367-796389 CCTTGAGAGGAGAGATGAGCAGG + Intronic
1077197396 11:1288287-1288309 CCCTAAGGGCAGAGCTTGGAAGG + Intronic
1077991224 11:7414117-7414139 CCTTGAGGGCAGAGATTAGACGG + Intronic
1080386809 11:31815313-31815335 TCTTGGGGGCAGAGGTTACAGGG - Intronic
1083009222 11:59379637-59379659 CGTTGAGAGCAGAGAATAAAGGG + Intergenic
1083180963 11:60984902-60984924 GCTTGAGGGCATAGATAATAGGG + Intronic
1083371927 11:62189305-62189327 ACTTGAGCCCAGAGGTTAGAGGG + Intergenic
1084326210 11:68401621-68401643 CCTTGGGGGCAGAGCTGAGGCGG + Intronic
1084873672 11:72115045-72115067 CCTTGAGGGCAGGGACTGAATGG + Intronic
1084888600 11:72225374-72225396 CCTTGAGGGTAGAGAATATGGGG + Intronic
1086568649 11:88257339-88257361 ACTTGAGGGCGGAGAGTAGGAGG - Intergenic
1086846095 11:91751482-91751504 GTATGAGGTCAGAGATTAGAAGG + Intergenic
1089223759 11:116897805-116897827 CCTGGGAGGCAGAGATTACAGGG + Intronic
1089267213 11:117272796-117272818 CCATGTGGGTAGAGATGAGATGG + Intronic
1089663661 11:120002600-120002622 CCTTGAGGCCAGAGCTTGGAGGG - Intergenic
1090404295 11:126467781-126467803 CCTTGAGGCCAGAGGCCAGAGGG + Intronic
1091318770 11:134635056-134635078 CCTTGAGGGAAGGGGTTACAGGG + Intergenic
1091381738 12:66576-66598 CCTGCAGGGCAGAGAGGAGAGGG - Intergenic
1092621739 12:10279140-10279162 GCTTGAGGGTGGAGAGTAGAAGG - Intergenic
1092748356 12:11694507-11694529 CATTGAGTGCAGAGACTAGGTGG + Intronic
1095124993 12:38466422-38466444 ACTTGGGGGCAAAGATGAGAGGG + Intergenic
1095190935 12:39257310-39257332 CCCTGAAGGCAGAGCTCAGAAGG + Intergenic
1095880836 12:47134540-47134562 CTTTGAGGTGAAAGATTAGATGG - Intronic
1097023642 12:56037655-56037677 CCATGAGAGCAGAGACTGGAAGG + Exonic
1100895039 12:99172048-99172070 TCTTCAAGGCACAGATTAGATGG - Intronic
1101842553 12:108339030-108339052 CCTTCCGGGCAGAGACCAGAGGG - Exonic
1102162011 12:110777017-110777039 CAGTGAGTGCAGAGATTACAAGG + Intergenic
1102220476 12:111191024-111191046 CCTTGAGGACAAACAGTAGAGGG + Intronic
1102736012 12:115160273-115160295 CCTGGAGGGAGGAGATAAGATGG + Intergenic
1102813475 12:115843760-115843782 AGATGAAGGCAGAGATTAGAGGG + Intergenic
1102855577 12:116290255-116290277 CCTTGAGGGCAGGGTCTTGAGGG + Intergenic
1102889212 12:116545285-116545307 CCTTGGGAGCAGAGATTACTGGG - Intergenic
1102944726 12:116976250-116976272 CTTGGAGGCCTGAGATTAGATGG + Intronic
1103607597 12:122098673-122098695 ACTTGAGGGTAGAAATTAGGAGG + Intronic
1104794644 12:131508944-131508966 CATTGAGGGCAAAGATAAAATGG + Intergenic
1107246637 13:38304789-38304811 CCTTGAAGACAGAGGTTGGATGG - Intergenic
1107918612 13:45179502-45179524 CCTTCAGGGCAGTGATAAGAAGG - Intronic
1108489979 13:50971729-50971751 TCTTGAGGGCAGAGACCATATGG + Intronic
1109198626 13:59407002-59407024 ACTTGAGGGCAGAGGGTAGAAGG - Intergenic
1109285316 13:60401692-60401714 TTTTGAGGGCAGAGATGGGATGG + Intronic
1109821627 13:67664629-67664651 CCTGAAGGGCAGAGAGAAGAGGG + Intergenic
1110338246 13:74357970-74357992 GCTTGAAGAAAGAGATTAGAGGG + Intergenic
1110559224 13:76892315-76892337 ACTTGAGGGTAGAGGTTGGATGG - Intergenic
1112353994 13:98659586-98659608 CCTTGAAGGAAGAGCTGAGAAGG + Intergenic
1113019386 13:105866254-105866276 CCTGGGAGGCAGAGATTACAGGG + Intergenic
1113398524 13:109970864-109970886 GCATGAGGGCAGAGATTTCAGGG + Intergenic
1114784130 14:25574853-25574875 CCTTCAGGGCTGAAATGAGATGG + Intergenic
1117044925 14:51803705-51803727 TCTTGAGGACAGAAACTAGAAGG - Intergenic
1118041564 14:61922527-61922549 ACTTGAGGGTAGAGAGTAGGAGG + Intergenic
1120727943 14:87966954-87966976 ACTTGAGGGCACTGACTAGATGG + Intronic
1121729699 14:96177881-96177903 GCTTGAAGGCAGAGTTTAGGAGG + Intergenic
1121823588 14:96991973-96991995 CCATGAGGTAAGAGATTTGAAGG + Intergenic
1121876849 14:97460680-97460702 CCTTCAGGGCAGAGAGAAGATGG + Intergenic
1122583184 14:102784648-102784670 CCTTGAAAACAGAGATCAGACGG - Intronic
1125313583 15:38407297-38407319 CATGGAGGACAGAAATTAGAGGG + Intergenic
1126283403 15:46983866-46983888 ACTTGAGGGCAGAGGGTGGAAGG - Intergenic
1127351730 15:58159691-58159713 TCATGAAGGCAGAGAGTAGATGG - Intronic
1128355569 15:66924010-66924032 CCTTGGGGGCAGAGAACATAAGG + Intergenic
1129191751 15:73941647-73941669 CCCTGAGGCCAGAGAGGAGACGG + Intronic
1129503426 15:76060671-76060693 CCTTGATGGCCGAGAAAAGATGG + Intronic
1130990149 15:88871262-88871284 CCTTGAGGGCACAGCATGGAAGG + Intronic
1132203333 15:99969964-99969986 CCTTCTGGACACAGATTAGAAGG - Intergenic
1133148396 16:3807906-3807928 CCTGGAGGGCACAGATCAGATGG - Intronic
1133286985 16:4695056-4695078 CCTTGAGGGCAAAGAGGAGCTGG - Exonic
1134313359 16:13096350-13096372 TCTTGAGGGCAGAGATGATATGG - Intronic
1134746219 16:16590936-16590958 CCTAGAGGGCAGAGCTAGGATGG + Intergenic
1134999262 16:18762764-18762786 CCTAGAGGGCAGAGCTAGGATGG - Intergenic
1135674881 16:24406856-24406878 CCTTGTGGGCAGAAACTGGAGGG - Intergenic
1138615309 16:58160690-58160712 TCTTGAGGGGATAAATTAGAGGG - Intronic
1142431200 16:90028719-90028741 CCATGAGGGCAGAGGCCAGAGGG - Intronic
1144524219 17:15976502-15976524 CCTTCAGGGTAAAGTTTAGAAGG - Intergenic
1147452873 17:40517004-40517026 GCTTGAAGACAGAGATAAGATGG - Intergenic
1149053046 17:52329504-52329526 CCTTGAGGTCAAAGAATAGGTGG + Intergenic
1149076365 17:52600002-52600024 ATATGAGGGGAGAGATTAGAGGG - Intergenic
1151694773 17:75708772-75708794 GCTTGTGGGCAGAGATTACACGG - Intergenic
1152837275 17:82541791-82541813 CCTTGAGCCCAGAAATTCGAGGG - Intronic
1157122731 18:44926633-44926655 CCAATAGGGCAGTGATTAGAAGG + Intronic
1158765058 18:60440928-60440950 CAATGGGGACAGAGATTAGAAGG - Intergenic
1160605756 18:80048542-80048564 CCATGAGGACAGAGACCAGAAGG + Intronic
1162677109 19:12307393-12307415 GCTGGTGGGCAGAGAATAGATGG - Intergenic
1163401831 19:17098667-17098689 CCTAGAGTGCTGAGATTATAGGG - Intronic
1165449661 19:35874672-35874694 CCGTGGGGGCAGAGAGCAGAGGG + Intronic
1166354420 19:42218435-42218457 CCTGGAGGGCAGAGATTGGAAGG - Intronic
1166569770 19:43786554-43786576 CCCAAAGGGCTGAGATTAGAGGG + Intergenic
1166798171 19:45440356-45440378 CCTTGAGGACAGAGATGGTAAGG - Intronic
926531306 2:14049665-14049687 CCTTGAGGGCAGAGGGTGGGAGG - Intergenic
926632235 2:15147123-15147145 CCTAGAGGGCAGACCTGAGACGG + Intergenic
928742307 2:34369548-34369570 CCTTCAGAGAAGAGATGAGAGGG - Intergenic
929554482 2:42916920-42916942 CCTGGAGGGCAAAGATCATATGG - Intergenic
929726217 2:44430461-44430483 CCTTCAGTGCAGAGAATAGATGG + Intronic
930413102 2:51052012-51052034 CCTTGAGTGCAAAAATTAGGAGG - Intergenic
933805061 2:85992759-85992781 GGTTGTGGGCAGAGAGTAGATGG - Intergenic
934581370 2:95443145-95443167 ACTTGAGGGCAAAGAGTTGAAGG - Intergenic
934598080 2:95633569-95633591 ACTTGAGGGCAAAGAGTTGAAGG + Intergenic
935808375 2:106771348-106771370 CCTTGAAGGGAGACTTTAGATGG - Intergenic
935824360 2:106929787-106929809 CCTTGAGGGCAAACATCATAAGG + Intergenic
940637588 2:156318219-156318241 AGTTGAAGGCAGAGATGAGAAGG - Intergenic
941112775 2:161434725-161434747 ACTTGAGGGTAGGGGTTAGAAGG - Intronic
941468315 2:165856017-165856039 CCTTGAGGACAAAATTTAGAGGG - Intergenic
943617113 2:190105710-190105732 CCCTGAGGGCTGAGCTGAGATGG - Intronic
944405367 2:199377922-199377944 CCATGAGAGCAGAGAGTGGAAGG + Intronic
945139366 2:206667392-206667414 CCTTGAGAGCAAAGACTTGAAGG - Intronic
945986056 2:216354552-216354574 CCAGGAGTGCAGAGATAAGATGG - Intronic
946359281 2:219209395-219209417 CCTGGAGGGCAGAGACAAGCGGG + Exonic
947269552 2:228318673-228318695 CCTTGGGGACAGAGATTAACAGG + Intergenic
947932209 2:233973439-233973461 CCATGAGGACAGGGATCAGAGGG - Intronic
1170587553 20:17746320-17746342 CCTTGAGGGATGTGATTAAAAGG + Intergenic
1171054688 20:21895162-21895184 CCTTGGGGGTTGAGCTTAGATGG + Intergenic
1173362188 20:42354850-42354872 CCTTGAGGAGAGAGGTCAGACGG + Intronic
1173697564 20:45032418-45032440 CCTTGAGGGCAGAGGGTGGGAGG - Intronic
1176042202 20:63071852-63071874 CCTTGTGGGCGGAGCTAAGAGGG - Intergenic
1176283468 20:64328257-64328279 CCTGCAGGGCAGAGAGGAGAGGG + Intergenic
1177320764 21:19516868-19516890 ACTTGAGGGGAGAGGTTAGTAGG + Intergenic
1177480445 21:21679683-21679705 TCTTTAGGGCAGAGATTATGGGG + Intergenic
1178178243 21:30129593-30129615 CCACGAGGGCAGAGTTTAAAAGG - Intergenic
1179043901 21:37828840-37828862 CCTGGAGGGTACAGAGTAGATGG - Intronic
1179320222 21:40284416-40284438 AATTTAGGGCAGAGTTTAGAGGG - Intronic
1179349610 21:40595542-40595564 CCTTCAGGGCAGAGCTTGGCTGG - Intronic
1182782510 22:32879577-32879599 CCATGAGGGCAGAGTTTTCATGG - Intronic
1182787226 22:32917932-32917954 CCCTGGGTGAAGAGATTAGATGG + Intronic
1182908667 22:33960762-33960784 CCGTGGAGACAGAGATTAGAAGG - Intergenic
1183271938 22:36867769-36867791 CCTTGGGGGCAGACACTGGATGG - Intronic
1184094146 22:42307470-42307492 CCGTGAGGGCAGAGATCAGAGGG - Intronic
1184947227 22:47812151-47812173 CCTTGAAGACAGAGATTGGAGGG + Intergenic
949710941 3:6870462-6870484 TCTTGAGGTCAGAGATGTGACGG + Intronic
952533775 3:34289551-34289573 CTTTGAGGGCAGGGATCAAAAGG + Intergenic
952560502 3:34587253-34587275 ACTTGAGGGTGGAGAGTAGAAGG - Intergenic
952877147 3:37955685-37955707 ACTTGAGGGTGGAGGTTAGAAGG + Intronic
954382475 3:50227074-50227096 ACTTCACAGCAGAGATTAGACGG - Intronic
955822783 3:62913947-62913969 CCTTGAGGGTAGTGCTGAGAAGG + Intergenic
956578030 3:70777441-70777463 CCTTGAGGGTGGAGGGTAGAAGG + Intergenic
957446392 3:80317103-80317125 CCTTTGGGGCAGAGACTATAGGG - Intergenic
957642552 3:82875459-82875481 CCTTGAGGAGAAAGATTTGAAGG - Intergenic
957733601 3:84177517-84177539 AATTGAGGGCAGAGAGTAGGAGG + Intergenic
960754661 3:120998331-120998353 CCTTTGGGGCACAGATTACAGGG - Intronic
963591326 3:147263358-147263380 CGTTGAAGGCACAGATTAAAGGG - Intergenic
965933176 3:174071980-174072002 TTCAGAGGGCAGAGATTAGAAGG + Intronic
968500451 4:947528-947550 CCTGGAGGCCAGAAATTTGAGGG + Intronic
969417698 4:7071730-7071752 CCTTGAGATCAGAGATTATCTGG + Intergenic
970024954 4:11613873-11613895 AATTGATGGCAGAGATTAGAGGG + Intergenic
970302645 4:14697654-14697676 ACCAGAGGGCAGAGATTATAGGG - Intergenic
972779810 4:42277220-42277242 ACTGGAGGGCAGAGATGACAAGG + Intergenic
973061173 4:45727217-45727239 CCTTGAAGAGAGTGATTAGAAGG + Intergenic
973582694 4:52359801-52359823 CCTAGAGGGAAGAGATATGAGGG - Intergenic
975212187 4:71713727-71713749 TCTTGATGGCAGAATTTAGAAGG + Intergenic
975478334 4:74848789-74848811 ACTTGAGGGTAGAGAGTGGAAGG - Intergenic
977414484 4:96714699-96714721 CCTTGATTTCAAAGATTAGATGG - Intergenic
978255593 4:106689236-106689258 CTTGGAGGGCAGAGATGACATGG - Intergenic
979158228 4:117425423-117425445 CCTTGAGGGCAGAGAGTGAGAGG - Intergenic
981569427 4:146135611-146135633 CCTTGAGGGTAGATCTTAGAAGG - Intergenic
981861759 4:149363833-149363855 GCTTGAGGGCAGTGAATATATGG - Intergenic
982115289 4:152093916-152093938 GCTTGAGGGCAGAGAGGGGACGG + Intergenic
985330074 4:188822560-188822582 CCGTGAGGGCTCAGAGTAGAGGG - Intergenic
985654999 5:1126633-1126655 ACTTGAGGGCAGAGAGTGGGAGG - Intergenic
985758631 5:1733545-1733567 CCCTGAGGGCAGGGAGGAGATGG - Intergenic
985830480 5:2224349-2224371 CCTTGTGGAGAGGGATTAGAAGG + Intergenic
990434030 5:55769476-55769498 ACTTTGGGGCAGAGATTATAGGG - Intronic
993139001 5:84006567-84006589 ACTTGAGAGCAGAGGTTGGAAGG + Intronic
993633862 5:90320353-90320375 CTTTGAGGGCAGAGGGTGGAAGG - Intergenic
994010617 5:94897825-94897847 CCTTGAGGGCAGAGTTTGGGAGG - Intronic
996794036 5:127324843-127324865 CCTTGAGGGTGGAGAGCAGAAGG - Intronic
997750910 5:136344962-136344984 CCATGAGGGCAGAGACTACAGGG + Intronic
998054589 5:139063441-139063463 CATTGAGGGTAGAGATCAAAGGG - Intronic
999664231 5:153895961-153895983 AGTTTGGGGCAGAGATTAGAGGG + Intergenic
1001189325 5:169613098-169613120 CCTTGAGGTGTGACATTAGATGG + Intergenic
1001503480 5:172257135-172257157 CCTTGAGGGCAGAGGATGGGAGG - Intronic
1003253755 6:4456669-4456691 CCTTGAGGGCAGAGCCTTCATGG + Intergenic
1005354959 6:24973519-24973541 CCTGGAAGGCAGAGATTGCAGGG + Intronic
1006814849 6:36843163-36843185 TCATGAGGGCAGAGGTGAGACGG + Intergenic
1007366472 6:41397708-41397730 ACTTGAGGGTAGAGCTGAGAGGG + Intergenic
1008819199 6:55609794-55609816 CCTTGAGGTCAGAGATCCCAGGG + Intergenic
1009642106 6:66351156-66351178 TATTGAGGGGAGAGATAAGAGGG + Intergenic
1010082521 6:71880831-71880853 CCTGTAGGGCAGAGTTTTGAAGG - Intergenic
1010710945 6:79173524-79173546 CCATGGAGGCAGAGATTGGAGGG + Intergenic
1011256654 6:85428815-85428837 CATTGAAGGCAGTGTTTAGAGGG + Intergenic
1011655744 6:89550515-89550537 TCTTGAGGGTAGTGATTGGAAGG + Intronic
1014836955 6:126170697-126170719 CCATGAGGGCACAGATCAGCGGG - Intergenic
1015402278 6:132799916-132799938 ACTTGAGGGCAGAGTCTGGATGG - Intergenic
1015419360 6:132988076-132988098 CCTGGAAGGCAGAGATCTGAGGG + Intergenic
1016831741 6:148440939-148440961 CCATGAGAGCAGAAATTACAGGG - Intronic
1016991711 6:149934541-149934563 CCCTGAGGGCAAAGAGCAGAGGG + Intergenic
1017004050 6:150016865-150016887 CCCTGAGGGCAAAGAGCAGAGGG - Intergenic
1017066447 6:150533530-150533552 ACTTGAGGGCAGAGATGGGGAGG - Intergenic
1018180977 6:161223181-161223203 CCTGGAGAACAGAGATGAGAGGG - Intronic
1018520052 6:164639121-164639143 CCTTGAGGGCAGAGGGTAGGAGG - Intergenic
1021021452 7:15603319-15603341 CATTGTGGGCAGAGATCAGGAGG + Intergenic
1021470006 7:20991188-20991210 GTTTGAGGGGAGAGTTTAGAGGG - Intergenic
1023305536 7:38822350-38822372 CTTTGAGGGTAGTGATTAGTTGG - Intronic
1023817591 7:43962282-43962304 CCTTGAGTGCAGAGACAGGAAGG - Intergenic
1027765532 7:82336051-82336073 GCTGGAGGGCTGAGATGAGAAGG + Intronic
1028850751 7:95534597-95534619 CATCGAGGGCAGAGAGTGGAGGG - Intronic
1029371654 7:100154622-100154644 CCCGCAGGGCTGAGATTAGAGGG - Exonic
1029742215 7:102497156-102497178 CCTTGAGTGCAGAGACAGGAAGG - Intronic
1029760205 7:102596321-102596343 CCTTGAGTGCAGAGACAGGAAGG - Intronic
1029813744 7:103074200-103074222 CCGTGAGGGCAGAAAATAGATGG - Intronic
1030617915 7:111757599-111757621 CCTTGTGCCCAGAGATTTGATGG - Intronic
1031984596 7:128155325-128155347 CCTGGAAGGCAGAGAGGAGAGGG + Intergenic
1032227031 7:130040544-130040566 CCTAAAGTGCAGAGATTACAGGG - Intronic
1032386933 7:131531654-131531676 CCATGAGGGCAGAGGTTGGCGGG - Intronic
1032594722 7:133228124-133228146 CCGTGTGTGCAGAGATCAGATGG + Intergenic
1033162313 7:139008644-139008666 CCTTAAGGGCAATGAATAGATGG - Intergenic
1034050810 7:147982715-147982737 CCTTGACAGGAGAGATAAGATGG + Intronic
1035459625 7:159030935-159030957 CCTTGGGGGCAGAGGCTGGAGGG + Intronic
1035559460 8:593794-593816 CCGTGAGGGGAGAGATGTGAGGG + Intergenic
1035559490 8:593946-593968 CCGTGAGGGGAGAGATGTGAAGG + Intergenic
1035824572 8:2630912-2630934 ACTAGGGGGCAGAGATTACAGGG - Intergenic
1037858007 8:22385345-22385367 CCAGGAGGGCAGAGACTGGAGGG - Intronic
1038034166 8:23673098-23673120 ACTTGAGGGCAGGGAGGAGATGG - Intergenic
1038473242 8:27843282-27843304 CCTGGAAGGCAGAAATGAGATGG + Intergenic
1039200905 8:35092554-35092576 CCTGGAGGGCAGAGAGTGGCAGG + Intergenic
1039392133 8:37189808-37189830 GCTTGAGTGCAGAAATTGGAGGG + Intergenic
1039752204 8:40488862-40488884 CCTGGAGGGCTGAGATTCAAAGG - Intergenic
1041715625 8:60929372-60929394 CGTTGCGGGCAGAGATGAGAAGG - Intergenic
1041834895 8:62200587-62200609 CCTTGAGGTCTGATATTAAAGGG + Intergenic
1042373419 8:68019085-68019107 CCTGGATGGCAGTGATTAGCTGG - Intronic
1043936112 8:86144200-86144222 GATTCAGGGCAGAGATCAGAAGG + Intronic
1044149590 8:88758966-88758988 CATTGAGGGCATAGTTTACAAGG - Intergenic
1045718831 8:105081573-105081595 ACTTGAGGGAAGAGGCTAGAAGG + Intronic
1046139543 8:110072344-110072366 ACTTGAGGGTAGAGGGTAGAAGG - Intergenic
1046709416 8:117493039-117493061 ACTTGAGGACAGAGGGTAGAAGG - Intergenic
1048881303 8:138874888-138874910 CCATGAGGGCTGAGATTGGGTGG - Intronic
1050908454 9:11036095-11036117 ACTTGAGGGGAGAGGTTAGGAGG - Intergenic
1052994170 9:34541091-34541113 CCTTGAGGGCAGAAATCAAAAGG + Intergenic
1056983447 9:91338874-91338896 ACTGGAGGGAAGAGATTAGAGGG + Intronic
1057392051 9:94648301-94648323 GCATGAGGGCAGAGATGGGAGGG - Intergenic
1058085265 9:100741313-100741335 TCATGAAGGCAGAGAGTAGAAGG - Intergenic
1058630615 9:106982740-106982762 CCTTGAAGGCAGCGATTAATCGG - Intronic
1058684389 9:107467296-107467318 GCTTGAGGACAGAGATGAGTTGG + Intergenic
1059173700 9:112150062-112150084 GCTAGAGGGCAGAGATGAGAGGG - Intronic
1059420495 9:114187555-114187577 CCTTGAGGTCAGACAGTTGAGGG - Intronic
1060342963 9:122792976-122792998 CCTTGAAGGGAGAGTGTAGAGGG - Intergenic
1060525182 9:124316426-124316448 CCCTGATGGCAGAGATTCAAAGG + Intronic
1061673400 9:132201935-132201957 CTCTGAGGTCAGAGAATAGAAGG + Intronic
1185691209 X:2156524-2156546 CTGTGAGGTCAGAGATTAGTAGG + Intergenic
1185713999 X:2326725-2326747 CTTTGAGGGCAGAGAGGACACGG - Intronic
1188775790 X:34216717-34216739 ACTTGAGGGTGGAGAGTAGAAGG + Intergenic
1192024990 X:67440462-67440484 ACTTGAGGGTGGAGATTGGAAGG - Intergenic
1192029868 X:67498423-67498445 TCTTGAAGACAGAGAGTAGAAGG + Intergenic
1192145998 X:68683114-68683136 CCTTGAGGGCAGTGACAAGGGGG - Intronic
1192767185 X:74152670-74152692 CCTTGAGGGTGGAGGTTGGAAGG + Intergenic
1193031494 X:76903636-76903658 TCTTGGGGGTAGAGAGTAGATGG + Intergenic
1193527337 X:82609709-82609731 CCTTGAAGGTAGAGATGACATGG + Intergenic
1194725381 X:97389766-97389788 CCTTGAGGGGATGGATTTGAGGG - Intronic
1194729647 X:97438723-97438745 CCTTGAATGCTGAGATTTGAGGG + Intronic
1195899765 X:109785541-109785563 CCTTGAGGGAATACACTAGAGGG - Intergenic
1195941257 X:110169796-110169818 CCTTCAGGGCAATGATTGGATGG + Intronic
1197242595 X:124135900-124135922 ACTTGAGGGCGGAGGTTAGGAGG - Intronic
1197670429 X:129271341-129271363 CCTTGAGTGGAAAGAATAGATGG - Intergenic
1198033208 X:132775370-132775392 CCTTGAGGTCAGCGATCATATGG + Intronic
1199822195 X:151460762-151460784 CCTAGAGGGGAGAGGATAGAGGG - Intergenic
1201861685 Y:18604669-18604691 ACTTGAGGTCAGAAATTCGAGGG + Intergenic
1201871638 Y:18715711-18715733 ACTTGAGGTCAGAAATTCGAGGG - Intergenic
1201949135 Y:19544013-19544035 ACTTTAGGGCAGATATTGGAGGG - Intergenic