ID: 1077992535

View in Genome Browser
Species Human (GRCh38)
Location 11:7424785-7424807
Sequence GTATGCACAAAGGTTGAGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 89
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 83}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077992535_1077992537 23 Left 1077992535 11:7424785-7424807 CCAAGCTCAACCTTTGTGCATAC 0: 1
1: 0
2: 0
3: 5
4: 83
Right 1077992537 11:7424831-7424853 CTGCATGTCTGACTGTCTGCTGG 0: 1
1: 0
2: 3
3: 23
4: 264
1077992535_1077992538 24 Left 1077992535 11:7424785-7424807 CCAAGCTCAACCTTTGTGCATAC 0: 1
1: 0
2: 0
3: 5
4: 83
Right 1077992538 11:7424832-7424854 TGCATGTCTGACTGTCTGCTGGG 0: 1
1: 0
2: 0
3: 22
4: 268

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077992535 Original CRISPR GTATGCACAAAGGTTGAGCT TGG (reversed) Intronic
904958195 1:34306431-34306453 GAATGCACATAGGTTGAGGAAGG - Intergenic
905650309 1:39652091-39652113 GAACACACAAAGGCTGAGCTAGG + Intergenic
908685769 1:66717691-66717713 GTATGCATAAAGTTTAAGATTGG - Intronic
908829570 1:68165596-68165618 ATATGAACAGAGCTTGAGCTCGG + Intronic
908942469 1:69452157-69452179 GAAAGCACAAAGGTAGAGTTTGG - Intergenic
909112613 1:71498751-71498773 GTATGCACATTGATTGGGCTTGG - Intronic
913062021 1:115217117-115217139 GCATGCCCAAATGATGAGCTGGG + Intergenic
920937830 1:210452241-210452263 CTATGCACAAAGGCTGAGCAAGG + Intronic
921052145 1:211518299-211518321 GTATGCCCAGAGGCTGAGCTTGG - Intergenic
922585912 1:226735552-226735574 GTATGCAGGAAGGCTGAGTTGGG + Exonic
1065995603 10:31056356-31056378 GTGTTCACAAACCTTGAGCTAGG - Intergenic
1069853694 10:71426608-71426630 GTCTGCACCAAGGGTGAACTTGG + Intronic
1073973979 10:109078365-109078387 GTATCAAAAAAGGTGGAGCTAGG - Intergenic
1075744561 10:124717705-124717727 GTATGCATAAGGATTGAGCTTGG - Intronic
1077992535 11:7424785-7424807 GTATGCACAAAGGTTGAGCTTGG - Intronic
1085433004 11:76472585-76472607 TTGGGCACGAAGGTTGAGCTTGG - Exonic
1112121010 13:96411418-96411440 ATATTTACAAAGGTTGAGATGGG + Intronic
1121235946 14:92391344-92391366 GTTGGCACAAGGGTTGGGCTGGG - Intronic
1123927658 15:25134060-25134082 GTATGGACACAGGGTGAGGTTGG + Intergenic
1129188937 15:73926655-73926677 GCATGGACAAAGCTAGAGCTGGG + Exonic
1131712674 15:95073174-95073196 ATCTGCAGAAAGGCTGAGCTCGG - Intergenic
1143558331 17:7676359-7676381 GTAAGGACAAGGGTTGGGCTGGG - Intronic
1149190113 17:54050862-54050884 GTATTTACAAAGATAGAGCTTGG - Intergenic
1149214514 17:54338297-54338319 CAATGCAGAAAGTTTGAGCTGGG - Intergenic
1149503734 17:57175425-57175447 GCATGCACAAAGGATGAACATGG - Intergenic
1150654508 17:67031149-67031171 CTTTGCACGAAGGTTGTGCTGGG + Exonic
1157321249 18:46636337-46636359 GTAGGCACAGAAGGTGAGCTGGG - Intronic
1159176450 18:64841543-64841565 GCAGGCAGAAAAGTTGAGCTAGG - Intergenic
1163128717 19:15258755-15258777 GTCTGCACAAAAATTTAGCTGGG - Intronic
1167644589 19:50698934-50698956 GTAGGCACAAGGGTTGAACGAGG - Intronic
925255643 2:2484742-2484764 GAATGAACATAGGTTGAGGTGGG + Intergenic
929904230 2:46032257-46032279 ATAGGCACAAACGATGAGCTGGG + Intronic
942668584 2:178349267-178349289 ATCTGCACAAAGGTTGGGGTTGG - Exonic
1174092168 20:48058275-48058297 GTATGCAGAAATGTGGAGCAGGG + Intergenic
1174327118 20:49788200-49788222 GTATACACATATGTTGAGATGGG - Intergenic
1177943734 21:27442500-27442522 GCATGGACAAAGGTTGGGGTGGG + Intergenic
1182420992 22:30248506-30248528 GTAAGAAGAAGGGTTGAGCTGGG - Intergenic
1183433438 22:37779843-37779865 TTAAGCACAAAGCTAGAGCTTGG - Intergenic
1185299896 22:50074124-50074146 GAATGCACCAAGACTGAGCTCGG + Intronic
949869992 3:8580283-8580305 GTGTGCAGAAAGGCTGGGCTGGG - Intergenic
952057969 3:29473049-29473071 GCATTCACAAACCTTGAGCTAGG + Intronic
954720831 3:52561457-52561479 GTAAGCACACATGTTGAGCTAGG - Intronic
962352011 3:134663305-134663327 GTATTCACAAATGTTTAGGTAGG + Intronic
964164239 3:153682338-153682360 GTGGACACAAAGGTTGAGGTTGG - Intergenic
968453452 4:685922-685944 GGATGCACAAAGTGTCAGCTCGG + Intronic
970385679 4:15554300-15554322 GTAGTCAGCAAGGTTGAGCTGGG - Intronic
976577168 4:86686481-86686503 TTATGCATAAAGGATGGGCTGGG + Intronic
976909179 4:90279290-90279312 GTATGCACATAGTTTTATCTGGG + Intronic
978119889 4:105065714-105065736 CTCTGCACAGAGCTTGAGCTGGG - Intergenic
979024745 4:115554962-115554984 GAAAGCACAAAGGTGGAGTTAGG - Intergenic
982539239 4:156646735-156646757 TTAAGCACATATGTTGAGCTTGG + Intergenic
983222692 4:165057821-165057843 GTAGAAACAAAGGCTGAGCTTGG - Intergenic
984528503 4:180886360-180886382 CAATGCTCAAATGTTGAGCTTGG - Intergenic
986187115 5:5454410-5454432 TTGTGCACAATGGTTGAGTTTGG + Intronic
986830416 5:11571378-11571400 TTATGCACAAAGCTGGAGCTAGG - Intronic
989235812 5:39147427-39147449 ATATGTACAAAAGTTTAGCTGGG - Intronic
990207936 5:53450422-53450444 AGATCCACAAAGGTTTAGCTAGG - Intergenic
994304536 5:98186972-98186994 GTATCAACAAAGGTTGAGAAAGG + Intergenic
995588639 5:113675025-113675047 GTGGACACAAAGGTTGAGGTTGG + Intergenic
998594297 5:143512250-143512272 GTATGAACAAAGATTAAGCCAGG - Intergenic
999622877 5:153490410-153490432 GTGTGCAGAAAGGTGGAGGTGGG - Intronic
999637224 5:153635463-153635485 GGCTGCACAAAGGCAGAGCTAGG + Intronic
1001324104 5:170707634-170707656 GTCAGCACAAATGTTGAGGTGGG - Intronic
1001476609 5:172055075-172055097 GTGTGGACAGAGGTAGAGCTTGG - Intronic
1003485104 6:6568850-6568872 GCATGGACAAAGGTGGAGGTGGG + Intergenic
1003812363 6:9798948-9798970 GTATGCATACTGGTTGAGATTGG - Intronic
1006620900 6:35363251-35363273 GCCTGCACACAGGTTGGGCTAGG + Intronic
1007621238 6:43216060-43216082 GTATGCTCAAAGAGGGAGCTGGG + Intronic
1011111751 6:83845304-83845326 GTATGCTCAAAGCTTAATCTCGG + Intergenic
1020446617 7:8275586-8275608 GAATGCATAATGTTTGAGCTGGG - Intergenic
1021020799 7:15596141-15596163 GTTGGCACAAAGGTTGAAATTGG - Intergenic
1023248101 7:38228449-38228471 ACATGCAAAAATGTTGAGCTTGG - Intronic
1028889432 7:95970467-95970489 ATCTGCACAAAGGGTGTGCTGGG + Intronic
1031709405 7:125026311-125026333 TTATGAACAACTGTTGAGCTAGG - Intergenic
1031859442 7:126961169-126961191 CTATGTAAAAAGGTTAAGCTTGG + Intronic
1034398748 7:150847556-150847578 CTATATACAAAGGTGGAGCTAGG - Intronic
1037003858 8:13752371-13752393 ACATGCAGAAAGGTTGAGATAGG + Intergenic
1041802114 8:61811866-61811888 CTCTCCACAAAGGGTGAGCTGGG - Intergenic
1050077964 9:1884378-1884400 GTATGAGCCAACGTTGAGCTGGG + Intergenic
1053428853 9:38028527-38028549 GTTTGCACAAAGGAGGAGATTGG - Intronic
1055123964 9:72697261-72697283 GGTTGCACAAAAGTAGAGCTGGG - Intronic
1055504069 9:76930447-76930469 GTATGCACAAGGGTAGAGAAAGG - Intergenic
1056458947 9:86790934-86790956 CTATGCACAAGATTTGAGCTAGG + Intergenic
1058970046 9:110072824-110072846 GTATCAACCAAGGTAGAGCTGGG - Intronic
1185516359 X:701865-701887 GTCTGCACCATGGTTGAGCCGGG - Intergenic
1195304351 X:103564901-103564923 GTATGTACACAGGTTTAACTAGG - Intergenic
1196762212 X:119210305-119210327 GCATTCACAAACTTTGAGCTAGG + Intergenic
1197614747 X:128678862-128678884 GTATGCACATATGGTCAGCTAGG + Intergenic
1201974154 Y:19830313-19830335 GTAGACACAAAGGATGAGGTTGG + Intergenic