ID: 1077992537

View in Genome Browser
Species Human (GRCh38)
Location 11:7424831-7424853
Sequence CTGCATGTCTGACTGTCTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 291
Summary {0: 1, 1: 0, 2: 3, 3: 23, 4: 264}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077992534_1077992537 30 Left 1077992534 11:7424778-7424800 CCTCACTCCAAGCTCAACCTTTG 0: 1
1: 0
2: 0
3: 15
4: 258
Right 1077992537 11:7424831-7424853 CTGCATGTCTGACTGTCTGCTGG 0: 1
1: 0
2: 3
3: 23
4: 264
1077992536_1077992537 13 Left 1077992536 11:7424795-7424817 CCTTTGTGCATACACGTACATAC 0: 1
1: 0
2: 2
3: 11
4: 155
Right 1077992537 11:7424831-7424853 CTGCATGTCTGACTGTCTGCTGG 0: 1
1: 0
2: 3
3: 23
4: 264
1077992535_1077992537 23 Left 1077992535 11:7424785-7424807 CCAAGCTCAACCTTTGTGCATAC 0: 1
1: 0
2: 0
3: 5
4: 83
Right 1077992537 11:7424831-7424853 CTGCATGTCTGACTGTCTGCTGG 0: 1
1: 0
2: 3
3: 23
4: 264

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077992537 Original CRISPR CTGCATGTCTGACTGTCTGC TGG Intronic
900049831 1:587696-587718 CTGAAGGTGAGACTGTCTGCTGG + Intergenic
900295267 1:1945986-1946008 CTGCATGTGTGCATGTGTGCGGG + Intronic
900299799 1:1971072-1971094 GTGCATGTATGAGTGTGTGCAGG - Intronic
902373268 1:16018175-16018197 CTGCGTGTCGGGCTGTCAGCAGG - Exonic
903994737 1:27298728-27298750 CTGCATGTCTGCTTGCCTGCTGG - Intronic
905190603 1:36230976-36230998 CTACATGTCAGACTGTTGGCAGG - Intronic
905412632 1:37782014-37782036 CTGCTTGCCTGCCTGCCTGCCGG - Intergenic
907712073 1:56892642-56892664 CTGCATGTCTGCTTGGCTGGAGG - Intronic
907853949 1:58283077-58283099 CTGTATGTCTGAATGTTTGAAGG - Intronic
908945769 1:69494816-69494838 CTGCATGTCTTCCAGTCTGCCGG - Intergenic
910377347 1:86587018-86587040 CTCCATGGCTGAGTGTCTTCAGG - Intergenic
910422918 1:87088144-87088166 CTCCTTGTCTGAATCTCTGCTGG + Intronic
912241727 1:107917657-107917679 TTTCATTTTTGACTGTCTGCTGG - Intronic
912297645 1:108485992-108486014 CTTAAGGTCTGACTGCCTGCAGG + Intergenic
914759570 1:150587719-150587741 CTGCATATCTGACTGCCTGTTGG - Intergenic
915300533 1:154948887-154948909 CTGTATGTCTGACTGCCTGCTGG + Intronic
917381093 1:174409539-174409561 CATAATGTCTGACTGCCTGCGGG + Intronic
917519071 1:175733359-175733381 CTGCACTTCTCACTGTCTCCTGG + Intronic
917833064 1:178914080-178914102 CTGCATGTCCCACTGTCTACTGG - Intronic
922153338 1:223022975-223022997 CTGCCTGTGTGAGTGTCTCCAGG - Intergenic
922627333 1:227061930-227061952 TTAAATATCTGACTGTCTGCTGG + Intronic
1063090881 10:2865561-2865583 CTGCAGATCTGAATGCCTGCGGG + Intergenic
1063272731 10:4529807-4529829 CTTCATGTCTGCCAGTGTGCTGG - Intergenic
1065002683 10:21351463-21351485 CATAAGGTCTGACTGTCTGCGGG + Intergenic
1067167584 10:43877992-43878014 CTTCATGTCTGCCTGTTTTCTGG + Intergenic
1067535187 10:47104327-47104349 CTGCATGTCTGAATGGCTTATGG + Intergenic
1068072037 10:52207416-52207438 CTGAGTACCTGACTGTCTGCTGG - Intronic
1069072860 10:64007503-64007525 CGTCAGGTCTGACTGCCTGCGGG - Intergenic
1069408383 10:68126807-68126829 CTGCATTTCTGGCTGCCTACTGG - Intronic
1069708843 10:70476446-70476468 CTGCAGCCCTGGCTGTCTGCTGG - Intergenic
1070313649 10:75291870-75291892 CTGCAGCTCTGGCTTTCTGCTGG + Intergenic
1070638267 10:78146678-78146700 CTGCAGGTCCTACTGACTGCTGG + Intergenic
1070855281 10:79603581-79603603 CTGCTTGTCTGCTAGTCTGCTGG + Intergenic
1071183885 10:83018815-83018837 CTTAAAGTCTGACTGTCTGTGGG + Intergenic
1076344470 10:129771074-129771096 CTGTCTGTCTGTCTGTCTGAAGG + Intergenic
1076919313 10:133443091-133443113 CTGCATGGATGACTGTGTGCCGG - Intergenic
1077992537 11:7424831-7424853 CTGCATGTCTGACTGTCTGCTGG + Intronic
1078085376 11:8230504-8230526 CTGTCTGTCTGTCCGTCTGCAGG - Exonic
1078446073 11:11405871-11405893 CTGCATGTCTTTCTTGCTGCAGG + Intronic
1080609680 11:33893046-33893068 CCGCATGCATGTCTGTCTGCTGG + Intergenic
1080979393 11:37382226-37382248 CTGTATTTCAGTCTGTCTGCTGG + Intergenic
1081559864 11:44203727-44203749 CTGCCTGCCTGCCTGCCTGCTGG + Intronic
1082955631 11:58867068-58867090 CCGCATGGCTGAGTGTCTGTGGG - Intronic
1082972242 11:59036065-59036087 CTGCATGGCTGAGTGTCTGTGGG - Intronic
1082976713 11:59079949-59079971 CTGCATGGCTGAGTGTCTGTGGG - Intergenic
1083771555 11:64870500-64870522 CTTTGTGTCTGACTTTCTGCTGG - Intronic
1084625926 11:70306972-70306994 GTGCATGTCTGGCCATCTGCTGG - Intronic
1084693911 11:70742735-70742757 CAGCGTGGCTGACTGGCTGCCGG + Intronic
1084795136 11:71500487-71500509 CTGAATGTCCTACTGTGTGCAGG + Intronic
1085253489 11:75159222-75159244 CTGTGTGTCTGACTGTCAGTCGG - Intronic
1085356384 11:75842003-75842025 TTACATGTCTGGCTGCCTGCTGG + Intronic
1085610631 11:77945577-77945599 GTGCATGTCTGCCTGTTTTCTGG - Intronic
1085636922 11:78166091-78166113 TTGCATGGCTGAATGTCAGCAGG - Intergenic
1086599772 11:88618541-88618563 CTGCATGTCAGACACTGTGCTGG + Intronic
1087388274 11:97501632-97501654 CTGCATGTTTGACAGTTTGATGG - Intergenic
1087916045 11:103812030-103812052 CTGCAGGTTGGACTGGCTGCAGG + Intergenic
1089579189 11:119470897-119470919 GGGCTGGTCTGACTGTCTGCTGG - Intergenic
1092853904 12:12655164-12655186 CTGCCTTCCTGACTGCCTGCTGG + Intergenic
1094525483 12:31228172-31228194 TTCCATGTCTTATTGTCTGCTGG - Intergenic
1095332598 12:40986471-40986493 CTACATATCTGAGTGTCTGGAGG + Intronic
1096035846 12:48469423-48469445 CATAAAGTCTGACTGTCTGCGGG - Intergenic
1098204465 12:68093393-68093415 CTGCTTGTCTCCCTGTCTGGTGG - Intergenic
1100792974 12:98150985-98151007 CTTCATGTCTGGCTTACTGCAGG - Intergenic
1101455150 12:104824261-104824283 CTGCCTGTGTGTCTGCCTGCTGG - Intronic
1103245709 12:119455327-119455349 CTGCCTTTCTTACTGTCTGTGGG - Intronic
1105531626 13:21226117-21226139 GTGCATGCCTGACTGTGTGTCGG + Intergenic
1106500146 13:30320542-30320564 CTTCATGTCTTCCTGCCTGCTGG - Intergenic
1109918138 13:69018612-69018634 CATAAGGTCTGACTGTCTGCAGG - Intergenic
1111223379 13:85236714-85236736 CGGCCTGTCTGCCTGTCTGTTGG - Intergenic
1112489341 13:99847972-99847994 CTGCCTGTCTGTCTGTCTCCTGG + Intronic
1113095430 13:106658714-106658736 CTGTATGTCTGGCACTCTGCTGG - Intergenic
1113629004 13:111867711-111867733 CCGCATTTCTGGCTTTCTGCAGG + Intergenic
1113710553 13:112461701-112461723 CTGCTTCCCTGACTCTCTGCAGG - Intergenic
1113911901 13:113845941-113845963 CCACACGTCTGAGTGTCTGCGGG - Intronic
1113993082 14:16043925-16043947 CTGCCTGTCTGTCTGCCTGTAGG + Intergenic
1114762359 14:25330267-25330289 ATGCATGGCTGCCTTTCTGCTGG - Intergenic
1119400983 14:74362199-74362221 CTGAAAGTCTGACTCACTGCTGG + Intergenic
1119849406 14:77856410-77856432 GTGTATGTATGACTGTCTGATGG + Intronic
1120297706 14:82664662-82664684 CTGGTTATCTGACTGACTGCTGG - Intergenic
1124627427 15:31316378-31316400 CTGGATGTCTCACTGTCAGCAGG + Intergenic
1124871308 15:33545785-33545807 CTGCATGCCTTAGTGGCTGCTGG - Intronic
1125678676 15:41516887-41516909 CCCCATGTCTGTCTGTCTGTCGG - Intergenic
1127960217 15:63885061-63885083 CTGCATGCCGGACTGCCTTCTGG - Intergenic
1128763418 15:70235392-70235414 CTGCAGCCCTGGCTGTCTGCAGG - Intergenic
1129336816 15:74857132-74857154 ATGAATGTCTGACTGCCTCCAGG + Intronic
1130067072 15:80613774-80613796 CTGAATGTCTTCCTGTCTGCAGG - Intergenic
1131340463 15:91595825-91595847 CTGAATGGCTGAATGGCTGCAGG - Intergenic
1136030978 16:27502824-27502846 CTGTCTGTCTGTCTGTCTGCTGG - Intronic
1137335019 16:47539971-47539993 CATAAGGTCTGACTGTCTGCAGG + Intronic
1137891742 16:52170160-52170182 CTGCATGTCCTACTGCTTGCAGG + Intergenic
1139631046 16:68232141-68232163 CTGCATGGGTGAGTGTCTGGAGG - Intronic
1140589779 16:76337893-76337915 CTTAAGGTCTGACTGCCTGCGGG - Intronic
1141612260 16:85188260-85188282 CTGCCTGACCGTCTGTCTGCGGG + Intergenic
1141902338 16:86999698-86999720 CTGCCTGCCTGACTGTGTCCTGG - Intergenic
1141941284 16:87277848-87277870 CTGCATGGCTGAAGGGCTGCGGG - Intronic
1142419837 16:89963438-89963460 CTGCAGGTCAGACTGCCAGCAGG + Exonic
1142778076 17:2157367-2157389 CTGCATGTATGAGTGTTTGTGGG - Intronic
1143203407 17:5127326-5127348 CTGCAGGTCTGTGTGGCTGCTGG + Intronic
1143999383 17:11038452-11038474 CTGCAGGTTGGAATGTCTGCAGG + Intergenic
1144776302 17:17786650-17786672 CTGCAGGTTTGTCTGACTGCTGG - Intronic
1145296604 17:21598115-21598137 CTTCATGTCTGCCTGGCGGCTGG - Intergenic
1146278142 17:31528414-31528436 GCGCATGTCTGACCGTCTGGAGG + Exonic
1146457980 17:33021941-33021963 CTGCTTGGCAGACAGTCTGCAGG - Intronic
1147386732 17:40087024-40087046 CTGCATGTGTGCCTGTGTGCTGG - Intronic
1148331122 17:46814584-46814606 CTGTCTGTCTGTCTGTCTGTGGG + Intronic
1148857854 17:50588737-50588759 CTGGCTGTCTGCCTGCCTGCTGG + Intronic
1152318022 17:79592150-79592172 ATGCATGTGTGTGTGTCTGCAGG + Intergenic
1152476560 17:80522173-80522195 CTGCAAGTCTGACTGTGTTAGGG + Intergenic
1152507576 17:80760716-80760738 GTGCGTGTCTGCCGGTCTGCAGG + Intronic
1152640968 17:81449068-81449090 CTGCCTGTGTGAATGCCTGCAGG + Intronic
1152950529 17:83227632-83227654 CTGAAGGTGAGACTGTCTGCTGG - Intergenic
1153263375 18:3245694-3245716 CAGCATGCCTGATTGTCTGGAGG - Intergenic
1156993539 18:43439350-43439372 CTTAAGGTCTGACTGCCTGCGGG + Intergenic
1157413702 18:47485030-47485052 CTGCCTGCCTGCCTGCCTGCCGG - Intergenic
1160302035 18:77690591-77690613 CTGTCTGTCTGTCTGACTGCGGG + Intergenic
1161144643 19:2670476-2670498 CAGCAAGTCTGACCGTCTGGAGG - Intronic
1161607263 19:5222086-5222108 CTGCCTGCCTGCCTGCCTGCTGG + Intronic
1162157135 19:8685948-8685970 CTGTCTGTCTGTCTGTCTGGAGG + Intergenic
1162339033 19:10080380-10080402 CTGAGTGTCAGGCTGTCTGCAGG - Intergenic
1162638036 19:11985632-11985654 CTGCATTTCTGGCTCTCTGGAGG + Intergenic
1162937494 19:13988543-13988565 CTGCATGGCTGACTGTTTGCAGG - Intronic
1164898407 19:31897345-31897367 CTGCCTGCCTGCCTGCCTGCTGG + Intergenic
1165706811 19:37982267-37982289 CTGCTTGTCTGATTGCCTGGTGG + Intronic
1167150918 19:47709115-47709137 CTGCAAGGCTGACTGCCTGCAGG + Intergenic
931761172 2:65418339-65418361 CTCCATGTCTGAGTTTATGCTGG - Intronic
932404106 2:71502616-71502638 CTGCATTTCTGACTGACAGGAGG - Intronic
933111629 2:78408452-78408474 CTGCATGGTTGAGTGTCTGCAGG + Intergenic
933385976 2:81610654-81610676 TTGCTGGTCTGAGTGTCTGCTGG + Intergenic
934164023 2:89278063-89278085 CTGGATGTCTGATTGTCCTCGGG - Intergenic
934203251 2:89904461-89904483 CTGGATGTCTGATTGTCCTCGGG + Intergenic
935737711 2:106119580-106119602 CTGGATGTGTCACTGTCTGGAGG - Intronic
936073842 2:109389155-109389177 CTGGATGTCTGTGTGTCTGCAGG - Intronic
936560387 2:113533359-113533381 CTGCATTTCTGACCGTAGGCAGG - Intergenic
936649816 2:114413384-114413406 CTGCCTGTTTGAGTGTCTGTTGG + Intergenic
938538617 2:132266922-132266944 CTGCCTGTCTGTCTGTCTGTCGG - Intergenic
938994148 2:136659555-136659577 CTGCATCCCTGTCTGTCTACAGG + Intergenic
939308871 2:140446493-140446515 CAGCATCTCTTATTGTCTGCAGG + Intronic
939428324 2:142070261-142070283 CTGCACGTCAGCCAGTCTGCTGG + Intronic
939881016 2:147631493-147631515 CTGAATGTCTGTATGTGTGCTGG - Intergenic
939882976 2:147650834-147650856 CTGCATTTCTAACTGGCTTCAGG - Intergenic
941756951 2:169197015-169197037 CTGCACGTGTGAGTGGCTGCAGG + Exonic
942120101 2:172768260-172768282 TTGCATGAATGATTGTCTGCTGG - Intronic
942606713 2:177699733-177699755 CTGCATTTCTGCCTTTCTGATGG + Intronic
946160468 2:217832629-217832651 CTGTAGGTCTGACTGTCTTTTGG - Intronic
946390498 2:219413206-219413228 CTGTATGTCTGTCTTTATGCTGG - Intergenic
948425180 2:237882889-237882911 CTGGCTGTCTGGCTGCCTGCCGG - Intronic
948525316 2:238567544-238567566 CTGCTTGTGTGCCTGCCTGCTGG - Intergenic
1171443672 20:25187546-25187568 CTGCATGGCTGAGCATCTGCAGG - Intergenic
1171768810 20:29305534-29305556 CTGTCTGTCTGTCTGTCTGTCGG - Intergenic
1171811945 20:29751855-29751877 CTGCCTGTCTGTCTGTCGGTAGG - Intergenic
1171866667 20:30490892-30490914 CTGCCTGCCTGCCTGCCTGCCGG + Intergenic
1171907733 20:30913793-30913815 CTGCCTGTCTGTCTGTCTGTAGG + Intergenic
1172330571 20:34073646-34073668 CTGACTGTCTGTCTGTCTGGTGG + Intronic
1172604603 20:36206241-36206263 CTGCATGTCAGATGGTCAGCCGG + Intronic
1172902000 20:38342123-38342145 CTGCAGTTCTGAATCTCTGCAGG - Intergenic
1173293921 20:41739045-41739067 CTGGAGGGCTCACTGTCTGCTGG - Intergenic
1173629433 20:44500170-44500192 TTGCAAGTTTGACTGTATGCAGG - Exonic
1174282006 20:49446204-49446226 CTGTCTGCCTGTCTGTCTGCTGG - Intronic
1175093178 20:56521324-56521346 CTTAAGGTCTGACTGCCTGCGGG - Intronic
1175171380 20:57083907-57083929 CTGCATGTCCCACTGTATCCAGG + Intergenic
1175409486 20:58756958-58756980 ATGCATGTGTGAGTGTGTGCGGG - Intergenic
1175440979 20:58991133-58991155 GTGCTTGTCTGATTGTCTGAAGG + Intronic
1177714922 21:24827043-24827065 CTGTATGTGTGACTGTGTGTGGG + Intergenic
1178342975 21:31801654-31801676 CTGTGTGTCTGGCTATCTGCTGG + Intergenic
1179458632 21:41517729-41517751 TTGCATGTCAGACTTTCTCCTGG - Intronic
1180314186 22:11263594-11263616 CTGCCTGTCTGTCTGCCTGTAGG - Intergenic
1180341174 22:11619982-11620004 CTTCCTGTCTGTCTGTCTGTAGG + Intergenic
1181166718 22:20987851-20987873 CTGCCTGTCTGCCTCTGTGCTGG - Intronic
1182879870 22:33724168-33724190 CTGCGTGGCTGACAGTGTGCCGG + Intronic
1183054195 22:35292096-35292118 CTGCATTTCTGGCTGTCTTTTGG - Intronic
1183818478 22:40323989-40324011 CTGCATCGCTGACAGTCTGCAGG + Exonic
1184304774 22:43589939-43589961 CTCCATGTCTTCCTGTTTGCTGG - Intronic
1184745099 22:46451526-46451548 GTGCATGTTTGACCGTCTTCTGG + Intronic
1185053002 22:48563460-48563482 CCGCATATCTGAGTGTCTGAAGG + Intronic
1185363545 22:50423638-50423660 CTGCATGTCTGTGAGTGTGCCGG + Intronic
1203237229 22_KI270732v1_random:17027-17049 ATGCATTTCTGAATGTCTGATGG + Intergenic
951706281 3:25547155-25547177 CTCCATGTGTGTCTGCCTGCAGG - Intronic
951842717 3:27051504-27051526 CATAAGGTCTGACTGTCTGCGGG + Intergenic
953118270 3:40014403-40014425 CTGAATGTCTGGATGTCTGCAGG - Intronic
956132615 3:66068676-66068698 CTGCATATCCAAATGTCTGCTGG + Intergenic
956840855 3:73138549-73138571 CTGCATGTCTGACTACAGGCTGG + Intergenic
959957135 3:112252034-112252056 CTGCATGTCAGACTGTAGACTGG + Intronic
961387905 3:126534710-126534732 CTGTCTGTCTGTCTGTCTCCCGG - Intronic
961388047 3:126535553-126535575 CTGTCTGTCTGTCTGTCTCCCGG - Intronic
961706939 3:128794176-128794198 CTGCTTCTCTCACTGTCTTCTGG + Intronic
961818925 3:129565339-129565361 CTGCATGTACAGCTGTCTGCGGG - Exonic
962218726 3:133545190-133545212 CTGCATGTCAGACAGACTACAGG + Intergenic
962599892 3:136983751-136983773 GTGGATGTCTGACTGGCAGCTGG + Intronic
964686231 3:159398894-159398916 TAGTATATCTGACTGTCTGCAGG - Intronic
964763660 3:160157888-160157910 CTGCAGGTCTCCTTGTCTGCTGG + Intergenic
965214078 3:165837996-165838018 CATCATGTATGACTGCCTGCAGG - Intergenic
968478358 4:823355-823377 CTGCCTGCCTGGCTGTCTCCCGG - Intronic
969599000 4:8164824-8164846 CTGCATGTCAGCCTCTGTGCTGG + Intergenic
969848256 4:9936616-9936638 CTGAATGTCTGCATGTGTGCTGG + Intronic
970142260 4:12995531-12995553 CTGGATGTAGGACAGTCTGCAGG + Intergenic
970325708 4:14921036-14921058 CTGCATCTCTGTTTGTCTTCTGG - Intergenic
971544057 4:27861944-27861966 CTGAATGTCTTACCATCTGCTGG + Intergenic
972639945 4:40916308-40916330 CTGTCTGTCTGTCTGTCTTCAGG - Intronic
972889892 4:43544179-43544201 CTAAATCTCTGACTATCTGCTGG + Intergenic
972924874 4:43991395-43991417 CTGTCTGTGTGACTGTCAGCAGG + Intergenic
973158934 4:46992754-46992776 CTTCCTGTCTGTCTGTCTGTGGG - Intronic
974409444 4:61520686-61520708 CTGTCTGTCTGTCTGTCTGAGGG + Intronic
974684161 4:65203082-65203104 CACCATGGCTGACTGACTGCAGG - Intergenic
976088375 4:81429613-81429635 CTACTTGTGTGTCTGTCTGCCGG - Intronic
977672793 4:99715480-99715502 CTGCAGGTCTGACTTACAGCAGG + Intergenic
977790062 4:101089079-101089101 CTGTATGTCTAGTTGTCTGCTGG - Intronic
979810793 4:125033498-125033520 CATAAGGTCTGACTGTCTGCGGG + Intergenic
980197895 4:129614754-129614776 CTGCAAGTCTCACTGGCTGCTGG + Intergenic
982947751 4:161647886-161647908 CTGCCTGTGTGTCTGCCTGCTGG - Intronic
984743812 4:183193928-183193950 CTGCCTGCCTGCCTGCCTGCTGG + Intronic
988972285 5:36481569-36481591 CTGCATGTTTGTGGGTCTGCTGG - Intergenic
989741396 5:44777270-44777292 CTGCATTTCTGAATTTCTGAAGG - Intergenic
993172403 5:84435774-84435796 CTTAAGGTCTGACTGCCTGCAGG + Intergenic
993636745 5:90353401-90353423 CTGCAGGTGTGACTGTCTCCAGG + Intergenic
994723470 5:103407394-103407416 CTGCCTGTCAGAGTGTCTTCTGG + Intergenic
997250489 5:132385155-132385177 CCTCCTGTCTGACTGTCTCCTGG - Intronic
998007114 5:138664402-138664424 CTGCTTGTCTGATTCACTGCTGG + Intronic
998542588 5:142996717-142996739 CTCCATTTCTAACTGTTTGCTGG - Intronic
999821092 5:155229816-155229838 CCGCATGTGTGAATGTCTGGGGG + Intergenic
999927528 5:156395468-156395490 CTGCAAGTCTGACTTTTAGCTGG + Intronic
1004109317 6:12699785-12699807 CTGCATGTCTAACAAGCTGCAGG + Intergenic
1005992024 6:30909152-30909174 CCACATGTCTGGCTGTCTTCAGG + Exonic
1006370533 6:33641262-33641284 CTGTCTGTCTGACTGTCAGTCGG - Intronic
1011747887 6:90424690-90424712 CTCCATATCTGACTCCCTGCTGG - Intergenic
1012287196 6:97405163-97405185 CTGCGTGTATGACTATTTGCAGG - Intergenic
1013178770 6:107700493-107700515 CTGGATGTCTGACCGTCTGCTGG + Intergenic
1015717977 6:136211635-136211657 CTCCATGTTTGACTCTCTGTGGG - Intergenic
1016402870 6:143699569-143699591 ATGCATTTCTGACTGTCCGTTGG + Intronic
1016894168 6:149036265-149036287 CTCCATCTCTGACTCTCAGCTGG + Intronic
1017488910 6:154926946-154926968 CTGCCTGTCTGACTTGATGCTGG - Intronic
1017573298 6:155771991-155772013 TAGCATGTCTGTGTGTCTGCTGG + Intergenic
1017613252 6:156213875-156213897 CAGCATGACTGTCTGTCTGCTGG + Intergenic
1019249672 6:170734988-170735010 CTGAAGGTGAGACTGTCTGCTGG - Intergenic
1019278698 7:189138-189160 GGGCATGTCTGACCCTCTGCGGG - Intergenic
1019934307 7:4244350-4244372 CTGCCTGTCTGACTGCCCACAGG + Intronic
1020183158 7:5938010-5938032 CTGCATGTCTGTGTGTGTGTGGG - Intronic
1020299755 7:6786747-6786769 CTGCATGTCTGTGTGTGTGTGGG + Intronic
1022527434 7:31047518-31047540 CTGCCTGCCTGAGAGTCTGCAGG + Intergenic
1023898534 7:44455189-44455211 CTACATTTCCAACTGTCTGCTGG + Intronic
1024456356 7:49612159-49612181 CTGCTTGTCTCACTGGCTACCGG - Intergenic
1024565212 7:50674885-50674907 CTGCATTTCTACCTGTCTCCAGG + Intronic
1026446833 7:70492104-70492126 CTGCCTGCCTCACTGCCTGCAGG + Intronic
1027575303 7:79923117-79923139 CAGCATGTCTAACTGTGCGCAGG + Intergenic
1028505561 7:91566621-91566643 CTGCATGTGTGCCTTTCTCCTGG - Intergenic
1028877970 7:95844743-95844765 CTGCATTTCTGACAATCTGATGG - Intronic
1029622658 7:101699665-101699687 CTGCCTGTCCATCTGTCTGCCGG - Intergenic
1029622668 7:101699749-101699771 CTGCCAGTCTGCCTGTCTGTGGG - Intergenic
1030289397 7:107857266-107857288 CTTCATTTCTGACTTCCTGCTGG + Intergenic
1030850082 7:114472857-114472879 GTGCATGTCTGTCTGTCTAGAGG + Intronic
1032427650 7:131834449-131834471 CTGCATGTCTGACTCCCCACTGG + Intergenic
1032512995 7:132486819-132486841 CTGCCTGCCTGACCGACTGCTGG + Intronic
1033159193 7:138981550-138981572 CTGCCTGCCTGCCTGCCTGCGGG + Intergenic
1033601283 7:142890257-142890279 CTGCAGGTGTGTGTGTCTGCAGG - Intergenic
1033601312 7:142890799-142890821 CTGCATGTGTGTGTGTCTGCAGG - Intergenic
1035498424 8:72668-72690 CTGAAGGTGAGACTGTCTGCTGG + Exonic
1035681118 8:1488845-1488867 CTGCATGCCCCACTATCTGCAGG - Intergenic
1036968647 8:13329245-13329267 CTGGATTTATGACTATCTGCTGG + Intronic
1038288973 8:26231707-26231729 CTGCTTGTCTGTCTGTCCACTGG + Intergenic
1038494366 8:27991059-27991081 CTGCAGGCCTGGCTCTCTGCAGG + Intronic
1041560893 8:59216190-59216212 CTGCGTGTCTTCTTGTCTGCTGG - Intergenic
1041718982 8:60959408-60959430 CTGCATGTCTGAGTGCCTAATGG + Intergenic
1045593562 8:103627276-103627298 CAGAAAGTCTGACTGCCTGCGGG - Intronic
1048135002 8:131739910-131739932 CTGCTTGTGTGTCTGCCTGCTGG - Intergenic
1049892291 9:81988-82010 CTGCATTTCTGACCATATGCAGG + Intergenic
1049953640 9:670925-670947 CTGATTCTCTTACTGTCTGCTGG + Intronic
1050271041 9:3945524-3945546 CTGCATGTATGTCTATCTCCTGG - Intronic
1051478555 9:17535249-17535271 TTGCATGTCTATCTGCCTGCTGG + Intergenic
1052535110 9:29736649-29736671 TTGCATGTCTGAGTCTTTGCTGG - Intergenic
1053733710 9:41083065-41083087 CTGCATTTCTGACCATATGCAGG + Intergenic
1054694702 9:68348487-68348509 CTGCATTTCTGACCGTAGGCAGG - Intronic
1056082699 9:83113473-83113495 CATAAGGTCTGACTGTCTGCGGG + Intergenic
1056391206 9:86143129-86143151 CTGCAGGCATGACTGTCTCCAGG - Intergenic
1058201212 9:102043263-102043285 CTGTCTGTCTGTCTGTCTGTTGG + Intergenic
1058304218 9:103416844-103416866 CTATATGTCTGTCTGTATGCTGG + Intergenic
1059443409 9:114323602-114323624 CTGAATCTTTGACTGTCAGCTGG - Intronic
1059444598 9:114330373-114330395 CTGAATCTTTGACTGTCAGCTGG - Intronic
1060181962 9:121540632-121540654 CTGCATGGCCCACTCTCTGCTGG + Intergenic
1060337659 9:122741837-122741859 CTGCATGTGTGACTGTGTCTAGG - Intergenic
1062566889 9:137167559-137167581 CCGTCTGTCTGTCTGTCTGCGGG - Intronic
1203610572 Un_KI270748v1:91926-91948 CTGAAGGTGAGACTGTCTGCTGG - Intergenic
1185956539 X:4497231-4497253 CTGCATGTCTAATTGGCTGGGGG - Intergenic
1190727003 X:53196277-53196299 CTGTTTGTCTGCCAGTCTGCTGG + Intronic
1190741339 X:53290838-53290860 CAGCTTGCCTGACTGTATGCAGG - Intronic
1190822672 X:53988213-53988235 CTGTATGTCTGTCTTTATGCTGG - Intronic
1190917963 X:54824259-54824281 CTGTGTGTCTGTCTGTCTCCTGG + Intergenic
1191104264 X:56762860-56762882 CTGCATGTGTCTCTGTGTGCGGG - Intergenic
1192637389 X:72832469-72832491 CTGCAGCTCCTACTGTCTGCTGG + Intronic
1192644325 X:72888345-72888367 CTGCAGCTCCTACTGTCTGCTGG - Intronic
1197375374 X:125676333-125676355 CTTAAGGTCTGACTGCCTGCAGG + Intergenic
1199393381 X:147307260-147307282 ATGCATGTCTGAATCTCAGCAGG + Intergenic
1201075744 Y:10186506-10186528 CTGTCTGTCTGTCTGTCTGTTGG + Intergenic