ID: 1077992538

View in Genome Browser
Species Human (GRCh38)
Location 11:7424832-7424854
Sequence TGCATGTCTGACTGTCTGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 291
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 268}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077992536_1077992538 14 Left 1077992536 11:7424795-7424817 CCTTTGTGCATACACGTACATAC 0: 1
1: 0
2: 2
3: 11
4: 155
Right 1077992538 11:7424832-7424854 TGCATGTCTGACTGTCTGCTGGG 0: 1
1: 0
2: 0
3: 22
4: 268
1077992535_1077992538 24 Left 1077992535 11:7424785-7424807 CCAAGCTCAACCTTTGTGCATAC 0: 1
1: 0
2: 0
3: 5
4: 83
Right 1077992538 11:7424832-7424854 TGCATGTCTGACTGTCTGCTGGG 0: 1
1: 0
2: 0
3: 22
4: 268

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077992538 Original CRISPR TGCATGTCTGACTGTCTGCT GGG Intronic
901331191 1:8410161-8410183 TGCATACCTGCCTGCCTGCTGGG + Intronic
904941963 1:34170218-34170240 TGCATGTCAGAGTCTGTGCTAGG + Intronic
905537139 1:38731116-38731138 TGCATTTCTGACTAACTGCCAGG - Intergenic
906905298 1:49882928-49882950 TGCATACCTGAATGTCTGGTGGG - Intronic
907122574 1:52020304-52020326 TGCAGGACTGGCTGTGTGCTTGG - Exonic
910288592 1:85579709-85579731 TGCACTTCTGGCTGGCTGCTTGG + Intergenic
910477169 1:87619837-87619859 TGCCTGTGTGTCTGCCTGCTAGG - Intergenic
910478521 1:87634203-87634225 TGCCTGTGTGTCTGCCTGCTAGG + Intergenic
910594178 1:88960693-88960715 TGAATGCCGTACTGTCTGCTGGG - Intronic
911100065 1:94088480-94088502 TACATATCCAACTGTCTGCTGGG + Intronic
911772879 1:101769540-101769562 TGCATCTCTGACTCTCTGTGAGG + Intergenic
912241726 1:107917656-107917678 TTCATTTTTGACTGTCTGCTGGG - Intronic
913246630 1:116875683-116875705 TGCCTGTGTGTCTGCCTGCTAGG + Intergenic
914380087 1:147107998-147108020 TGCATCTCAGCCTGTCTGCATGG + Intergenic
914859082 1:151371947-151371969 TCCATGTCAGGCTGGCTGCTGGG + Intronic
916284687 1:163093528-163093550 TGCCTGTGTGTCTGCCTGCTAGG - Intergenic
917403635 1:174680161-174680183 TGCATGTCTGACAGTGGACTTGG + Intronic
917427760 1:174933340-174933362 TGCCTTTCTGACATTCTGCTTGG + Intronic
917519072 1:175733360-175733382 TGCACTTCTCACTGTCTCCTGGG + Intronic
917688753 1:177445838-177445860 TGCATGTCTGTGTGTCTGTGTGG + Intergenic
918540927 1:185632230-185632252 TGTATATCTGATTGTCTCCTTGG + Intergenic
1062768821 10:84101-84123 TGCATGTGTGAGTGTGTGGTGGG - Intergenic
1062864572 10:840815-840837 TGTGTGTCTGAGTCTCTGCTAGG + Intronic
1063272730 10:4529806-4529828 TTCATGTCTGCCAGTGTGCTGGG - Intergenic
1063390057 10:5644154-5644176 TTCATCTCTGACTCTCTTCTTGG - Intronic
1064851567 10:19714448-19714470 TGCCTGCATGTCTGTCTGCTAGG + Intronic
1067230434 10:44403955-44403977 TACATGTCTGTTTCTCTGCTTGG + Intergenic
1067820835 10:49528731-49528753 TGCAGGCATGCCTGTCTGCTGGG - Intronic
1069323327 10:67200731-67200753 TGCATGCGTGACTGTCTTTTGGG - Intronic
1074143108 10:110694106-110694128 TGCATGAATGACTGTCTACCAGG - Intronic
1075618489 10:123908519-123908541 TGCATGTCTGTCTCCCTACTAGG - Intronic
1076919312 10:133443090-133443112 TGCATGGATGACTGTGTGCCGGG - Intergenic
1076986885 11:243890-243912 TGCATTGCTTACTGTGTGCTGGG + Intronic
1077586733 11:3459581-3459603 TGCCTGTGTGCCTGCCTGCTAGG + Intergenic
1077992538 11:7424832-7424854 TGCATGTCTGACTGTCTGCTGGG + Intronic
1078432969 11:11301835-11301857 TGCATGTCTGTCTCTCCGCCAGG - Intronic
1078603086 11:12750543-12750565 TGTCTGTCTGTCTGTCTACTTGG - Intronic
1079371083 11:19853177-19853199 TGCATTTTTGACAGTCTCCTGGG + Intronic
1080609681 11:33893047-33893069 CGCATGCATGTCTGTCTGCTGGG + Intergenic
1080979394 11:37382227-37382249 TGTATTTCAGTCTGTCTGCTGGG + Intergenic
1081018948 11:37919221-37919243 TCTATGTCTTAGTGTCTGCTAGG - Intergenic
1081061316 11:38481500-38481522 TGCCTGTGTGTCTGCCTGCTAGG - Intergenic
1083925123 11:65801449-65801471 TGCAGGTCTTGCTGTCTGCTCGG - Intergenic
1084288113 11:68145037-68145059 TGTCTGTCTGTCTGTCTCCTCGG + Intergenic
1084323147 11:68384668-68384690 AGCATTTCTGACTGTGTCCTAGG - Intronic
1084625925 11:70306971-70306993 TGCATGTCTGGCCATCTGCTGGG - Intronic
1084830266 11:71763365-71763387 TGCCTGTGTGTCTGCCTGCTAGG - Intergenic
1085877297 11:80424271-80424293 TGCATACCTGACAGTCTCCTGGG + Intergenic
1086873649 11:92069872-92069894 TGCTTCTCTTACTGTCTGTTTGG - Intergenic
1087123555 11:94599932-94599954 TGCATTTCTAACTGGCTTCTAGG + Intronic
1087215144 11:95485633-95485655 TGCAAGTCTGACTTCATGCTGGG - Intergenic
1087335552 11:96839835-96839857 TGCTTGTGTGCCTGCCTGCTAGG + Intergenic
1087561149 11:99792582-99792604 TGTCTGTCTGTCTGTCTGCAAGG + Intronic
1089579188 11:119470896-119470918 GGCTGGTCTGACTGTCTGCTGGG - Intergenic
1091939685 12:4467486-4467508 TGCATGTGTGAATCTCTGCCTGG - Intergenic
1092412969 12:8268314-8268336 TGCCTGTGTGTCTGTCTGCTAGG + Intergenic
1092853905 12:12655165-12655187 TGCCTTCCTGACTGCCTGCTGGG + Intergenic
1094220652 12:27989606-27989628 TGGTTGTCTCACTGTTTGCTGGG + Intergenic
1094525482 12:31228171-31228193 TCCATGTCTTATTGTCTGCTGGG - Intergenic
1094549856 12:31440809-31440831 TGCATGCCTGACTGCCTCCCAGG + Intronic
1094722836 12:33082905-33082927 TGAATGTTGAACTGTCTGCTAGG + Intergenic
1098032810 12:66271815-66271837 TTCATGCCTGACATTCTGCTAGG - Intergenic
1101057344 12:100932316-100932338 TGTATTTCTTACTGTCTTCTAGG + Intronic
1101455149 12:104824260-104824282 TGCCTGTGTGTCTGCCTGCTGGG - Intronic
1102524008 12:113498114-113498136 TGTGTGTCTGATTGTCTGCCTGG + Intergenic
1102730384 12:115103897-115103919 TCCCTGTCTGACTTCCTGCTTGG + Intergenic
1103666239 12:122568454-122568476 TGCAAGTCTGACTGGGTGATGGG + Intronic
1104180334 12:126373561-126373583 TGCATGTCTGATTGCCTCCTTGG - Intergenic
1106642309 13:31597305-31597327 TGCATGTGTGACAGTGTGCCAGG - Intergenic
1108884639 13:55165049-55165071 TGCAGGTCTGACAGTCTCCCAGG - Intergenic
1110654535 13:77981683-77981705 TGCATTTCTGATAGTCTGCCAGG + Intergenic
1111427479 13:88106491-88106513 TGCAAGTCTGTCTTTCTCCTTGG - Intergenic
1114762358 14:25330266-25330288 TGCATGGCTGCCTTTCTGCTGGG - Intergenic
1115100979 14:29699340-29699362 TTAATTTTTGACTGTCTGCTAGG + Intronic
1116922208 14:50590667-50590689 TGCATGTCTGTCTCGCTGTTAGG + Intronic
1116977572 14:51132780-51132802 TGCATGTTGGCCTGTCTTCTAGG - Intergenic
1123055472 14:105567233-105567255 TGCATGTGTGAGTGTGAGCTTGG + Intergenic
1126109056 15:45165234-45165256 TGCATGTCTGTATGTGTGTTGGG + Exonic
1128716878 15:69915051-69915073 TTCCTGTCTGCATGTCTGCTTGG + Intergenic
1128832215 15:70779908-70779930 TGCATATCTGACTCTCTCATTGG - Intergenic
1132457679 16:33125-33147 TGCATGTGTGAGTGTGTGGTGGG - Intergenic
1134825647 16:17282097-17282119 TGCAGCACTGACTGTATGCTAGG + Intronic
1135195351 16:20389648-20389670 TGGCTCCCTGACTGTCTGCTTGG + Intronic
1138322386 16:56126917-56126939 GGTATGTTTGACTGTCTGATGGG - Intergenic
1138341464 16:56292128-56292150 TGCAGTTCAGATTGTCTGCTAGG - Intronic
1139064157 16:63291726-63291748 TGCCTGTGTGTCTGCCTGCTAGG - Intergenic
1141560213 16:84862884-84862906 TTCATGGCTGACTGCCCGCTGGG + Intronic
1141980314 16:87546237-87546259 TTCATGACTGACTGTCCCCTGGG + Intergenic
1142571995 17:880833-880855 TGCATTACTTAGTGTCTGCTTGG - Intronic
1143284100 17:5776415-5776437 TACATGTCTGGCTGTTGGCTGGG + Intronic
1145353958 17:22119308-22119330 TGCTTGTGTGTCTGCCTGCTAGG + Intergenic
1146193775 17:30793763-30793785 AGCATGTGGGCCTGTCTGCTTGG - Intronic
1146917100 17:36685006-36685028 TGCATTTCTGCCTGCATGCTGGG + Intergenic
1147386731 17:40087023-40087045 TGCATGTGTGCCTGTGTGCTGGG - Intronic
1147512926 17:41087574-41087596 TGCATATCTGATTGACTCCTTGG + Intronic
1148777358 17:50103133-50103155 TGCCAGCCTGATTGTCTGCTGGG + Intronic
1149236864 17:54601557-54601579 TGCATGTTTGCCTGTTTGCATGG - Intergenic
1152318023 17:79592151-79592173 TGCATGTGTGTGTGTCTGCAGGG + Intergenic
1152698911 17:81809736-81809758 TGCCTGTCTGTCTGTCTGTCTGG + Intronic
1152961707 18:83934-83956 TGCATGTGTGAGTGTGTGGTGGG - Intergenic
1153868971 18:9298790-9298812 TGCCTGGCTGACTGTTAGCTAGG + Intergenic
1154409518 18:14130112-14130134 TCCATGTCTGACTCTGTGATAGG - Intronic
1155246195 18:23912320-23912342 TACATGTCTGATTGTATGCCAGG + Intronic
1156043344 18:32849341-32849363 TGTATGTCTGGCTCTTTGCTGGG - Intergenic
1156278007 18:35603330-35603352 TGTTTCTCTTACTGTCTGCTTGG + Intronic
1156389633 18:36638488-36638510 TGCCTATCTGCCTGCCTGCTTGG + Intronic
1156551955 18:38027639-38027661 TGCCTGTGTGTCTGCCTGCTAGG + Intergenic
1156903446 18:42327622-42327644 TGCATCTCTGATTGCCTCCTTGG + Intergenic
1158144989 18:54302202-54302224 TGAATGTCTGTCTGTCTGGCTGG + Intronic
1160871778 19:1281060-1281082 TGCGTGTCTGCGTGTCTGCGTGG - Intergenic
1161843239 19:6694786-6694808 TGCATGGCTGAGTGGCTGTTCGG + Intronic
1162067421 19:8134567-8134589 TGCATATTAGTCTGTCTGCTGGG + Intronic
1163913381 19:20216361-20216383 TGTATGTCTGGCTGTGTGATAGG - Intergenic
1164898408 19:31897346-31897368 TGCCTGCCTGCCTGCCTGCTGGG + Intergenic
1165025757 19:32960076-32960098 TTCATGTCTCACTGTCTCCATGG - Intronic
1165188714 19:34044147-34044169 GGCATGGCTGACTGCCTGCATGG + Intergenic
1165744210 19:38221168-38221190 TGGATGTCTCAGTGTCTGGTTGG - Intronic
926035027 2:9630047-9630069 GGCTTGCCGGACTGTCTGCTGGG - Intronic
926971228 2:18469561-18469583 TCCATGTCTGATTGTCAGTTTGG - Intergenic
927262348 2:21104303-21104325 TGCCTGTCTGTCTGTATGCTTGG - Intergenic
927963949 2:27257799-27257821 TGCGTGTCTGTGTGTCTGGTGGG + Intronic
928739469 2:34333007-34333029 TGCATTTCTGACATTCTTCTTGG - Intergenic
928956511 2:36874895-36874917 TGCATGTCTGACTGTCCATCTGG - Intronic
929902161 2:46014733-46014755 TGCATGTCTATCTCTCTACTAGG - Intronic
930423155 2:51178740-51178762 TTAAGGTCTGACTGTCTGCATGG + Intergenic
931761171 2:65418338-65418360 TCCATGTCTGAGTTTATGCTGGG - Intronic
931973995 2:67622809-67622831 TGCATTTCTGACTATTTCCTAGG - Intergenic
933111630 2:78408453-78408475 TGCATGGTTGAGTGTCTGCAGGG + Intergenic
934572993 2:95383880-95383902 TGCCTGTCTGTCTGTCTTATTGG - Intronic
938765520 2:134458560-134458582 CTCATATCTGAGTGTCTGCTGGG + Intronic
939818848 2:146930775-146930797 TGCCTGTGTGTCTGCCTGCTAGG - Intergenic
941224942 2:162837057-162837079 TGCTTGTCTGAGTGTCCACTAGG - Intronic
941308491 2:163899426-163899448 TGGATGTCTAAATCTCTGCTAGG - Intergenic
942240289 2:173957303-173957325 TGGATGTGTGTATGTCTGCTTGG - Intronic
942606714 2:177699734-177699756 TGCATTTCTGCCTTTCTGATGGG + Intronic
946160467 2:217832628-217832650 TGTAGGTCTGACTGTCTTTTGGG - Intronic
946286248 2:218705430-218705452 AGCATGGCTGACTGACTGCCTGG - Intergenic
947207931 2:227679504-227679526 TGCATCTGTGACAGTCTCCTAGG + Intergenic
948525315 2:238567543-238567565 TGCTTGTGTGCCTGCCTGCTGGG - Intergenic
1170504766 20:17013838-17013860 TGCTTGATTGACTGGCTGCTTGG - Intergenic
1171230039 20:23476773-23476795 TGCATGTGTGAGTGTGTGTTAGG + Intergenic
1172330572 20:34073647-34073669 TGACTGTCTGTCTGTCTGGTGGG + Intronic
1173549158 20:43920516-43920538 TGGATGTCTGCATCTCTGCTAGG + Intronic
1173817138 20:45997001-45997023 TGCATTTCTGACTGGCTCCCAGG + Intergenic
1174062141 20:47840246-47840268 TGCATGTCTAACTCTCTGTAAGG + Intergenic
1174069362 20:47888985-47889007 TGCATGTCTAACTCTCTGTAAGG - Intergenic
1174282005 20:49446203-49446225 TGTCTGCCTGTCTGTCTGCTGGG - Intronic
1176728998 21:10471093-10471115 TGAATGTTTGTCTGTCTTCTGGG + Intergenic
1179458631 21:41517728-41517750 TGCATGTCAGACTTTCTCCTGGG - Intronic
1180619748 22:17153134-17153156 TACATGTCTGGCTGAGTGCTTGG - Intronic
1181166717 22:20987850-20987872 TGCCTGTCTGCCTCTGTGCTGGG - Intronic
1182031479 22:27162569-27162591 TGCATGTGAGACTCTCTTCTAGG + Intergenic
1183054194 22:35292095-35292117 TGCATTTCTGGCTGTCTTTTGGG - Intronic
1183730968 22:39618362-39618384 TGCGTGTGTGACTGTGTGCATGG + Intronic
1184304773 22:43589938-43589960 TCCATGTCTTCCTGTTTGCTGGG - Intronic
949887685 3:8709469-8709491 TGCATGTCTGACCGGCTTCCAGG + Intronic
950423681 3:12913350-12913372 TCCATGTCTGGCTGTCTGCGTGG - Intronic
952108227 3:30093097-30093119 TGCATGTCTGTCTGATGGCTGGG + Intergenic
952564243 3:34635601-34635623 TGCTTGTGTGCCTGCCTGCTAGG + Intergenic
952824125 3:37510643-37510665 TTCAGGCCTGAATGTCTGCTTGG + Intronic
954513034 3:51144680-51144702 TGCATGTCTAACTGCCTACCAGG + Intronic
955700943 3:61681472-61681494 TTCATGTCAGACTGCCTGCTAGG + Intronic
958638180 3:96772367-96772389 TGCATATCTGATTGCCTCCTTGG - Intergenic
959315819 3:104805339-104805361 TGTGTGTCTGGCTGTCTGGTTGG - Intergenic
959957136 3:112252035-112252057 TGCATGTCAGACTGTAGACTGGG + Intronic
960248942 3:115431138-115431160 TGAAAGTCTGTCTGTCTGTTTGG + Intergenic
960453204 3:117836412-117836434 TGCATGAATGACTGTATACTAGG - Intergenic
961112277 3:124295101-124295123 TGCAAGGCTGGCTGTCTGCAAGG - Intronic
961531301 3:127542000-127542022 TGCCTGCCTGTCTGTCTGCTTGG - Intergenic
961890531 3:130126968-130126990 TGCCTGTGTGTCTGCCTGCTAGG + Intergenic
962745642 3:138395816-138395838 GGAATGTCTGAGTGCCTGCTAGG - Intronic
963046760 3:141108220-141108242 TGCCTCTCTGTCTGCCTGCTTGG - Intronic
963666001 3:148187150-148187172 TGAATGTTGGACTGGCTGCTTGG - Intergenic
969001914 4:3989380-3989402 TGCCTGTGTGTCTGCCTGCTAGG + Intergenic
969752090 4:9119153-9119175 TGCCTGTGTGTCTGCCTGCTAGG - Intergenic
969812002 4:9655428-9655450 TGCCTGTGTGTCTGCCTGCTAGG - Intergenic
970144275 4:13017734-13017756 TACATGTCTGACTTTATGCCAGG - Intergenic
970194743 4:13542893-13542915 TGCATTTCCGTCTCTCTGCTTGG + Intronic
974827956 4:67153234-67153256 TGCATGCCTGGATGTCTGCCTGG + Intergenic
974957576 4:68661259-68661281 TGCATATCTGATTGCCTCCTTGG + Intronic
976260879 4:83143744-83143766 TGCATAACTGATTGTTTGCTTGG + Intergenic
981159598 4:141482059-141482081 TGATTCTCTCACTGTCTGCTTGG + Intergenic
981408892 4:144404586-144404608 TGCATTTCTGAAAGTGTGCTGGG + Intergenic
981798907 4:148633542-148633564 TGAATTTCTGACTCTCTGATAGG + Intergenic
981827541 4:148961001-148961023 TGCCTGGCTGAATGTCTACTAGG - Intergenic
982147027 4:152405931-152405953 TGCATTTCTAGCTGTCTGTTGGG - Intronic
982781891 4:159500047-159500069 TGCATGTGTGTTTGTGTGCTGGG + Intergenic
982947750 4:161647885-161647907 TGCCTGTGTGTCTGCCTGCTGGG - Intronic
983145989 4:164215393-164215415 TGCTTGTGTGTCTGCCTGCTAGG + Intronic
984743813 4:183193929-183193951 TGCCTGCCTGCCTGCCTGCTGGG + Intronic
986238090 5:5931003-5931025 TGCATGCCTGAATGTGTGCATGG + Intergenic
986238093 5:5931077-5931099 TGCATGCCTGAATGTGTGCAAGG + Intergenic
987951845 5:24686667-24686689 TGCATTTCTGACTGGAAGCTTGG + Intergenic
988038131 5:25853673-25853695 TGCCTGTGTGTCTGCCTGCTAGG + Intergenic
988972284 5:36481568-36481590 TGCATGTTTGTGGGTCTGCTGGG - Intergenic
988995991 5:36715368-36715390 TGCATGTGTGTATGTGTGCTGGG - Intergenic
990743082 5:58932197-58932219 TTCATGTCTGGCTGCGTGCTGGG - Intergenic
994954979 5:106517305-106517327 TGCATGCCTCAATGTCTTCTAGG + Intergenic
996170977 5:120290992-120291014 AGTATGTCTGTCTGTCTACTTGG + Intergenic
996541082 5:124630496-124630518 TGCATGTGTGCGTGTGTGCTAGG + Intergenic
997074524 5:130656837-130656859 TGCATGTGTGTGTGTCTGTTGGG + Intergenic
997250488 5:132385154-132385176 CTCCTGTCTGACTGTCTCCTGGG - Intronic
999103778 5:149050599-149050621 TGCTTATCTGTCTGTCAGCTTGG - Intronic
999877157 5:155820291-155820313 TCCAATTCTGCCTGTCTGCTGGG - Intergenic
999933394 5:156458159-156458181 TGCCTGCCTGCCTGCCTGCTGGG - Intronic
1000983146 5:167838487-167838509 TCCATTGCTTACTGTCTGCTTGG + Intronic
1001272747 5:170327882-170327904 CCCATGACTGAGTGTCTGCTTGG + Intergenic
1003520947 6:6857644-6857666 TGCATTTCTTACAGGCTGCTGGG + Intergenic
1003965676 6:11250087-11250109 TGGATGTCTGACTGTGTCTTTGG - Intronic
1003973276 6:11319408-11319430 TGCATGTGTGACTGTATGTGAGG - Intronic
1004316168 6:14589888-14589910 TGCTTGGGTGAATGTCTGCTTGG - Intergenic
1004317078 6:14599037-14599059 TGCATGTCCAACTGCCTTCTTGG + Intergenic
1005423956 6:25681769-25681791 TGCATGTCAGCCTCTCTGTTAGG - Intronic
1006787236 6:36676653-36676675 TGCTTGTGTGAGTGTGTGCTGGG + Intronic
1007378746 6:41473165-41473187 TGTCTGTCTGTCTGTCTGCATGG + Intergenic
1009801675 6:68545754-68545776 TGCAAGTCTCACTGGCTGGTGGG - Intergenic
1011326349 6:86152769-86152791 TGCTTGTGTGTCTGCCTGCTAGG + Intergenic
1013112977 6:107079017-107079039 TGCTTGTGTGCCTGCCTGCTAGG - Intronic
1015868953 6:137756188-137756210 TGTATGTCTAACTGTCTACTTGG - Intergenic
1016894169 6:149036266-149036288 TCCATCTCTGACTCTCAGCTGGG + Intronic
1016938670 6:149467110-149467132 TGCATTCCTGTCTGTGTGCTGGG - Intronic
1017402870 6:154084407-154084429 TGTGTGTCTGTCTGTCTGTTGGG - Intronic
1017573299 6:155771992-155772014 AGCATGTCTGTGTGTCTGCTGGG + Intergenic
1017613253 6:156213876-156213898 AGCATGACTGTCTGTCTGCTGGG + Intergenic
1018511308 6:164527293-164527315 TGCATGTCTGGCATTGTGCTTGG + Intergenic
1019278697 7:189137-189159 GGCATGTCTGACCCTCTGCGGGG - Intergenic
1021862385 7:24919291-24919313 TGTATGTCTGTCTTTATGCTAGG - Intronic
1024157348 7:46638839-46638861 GCCATGCCTGACTCTCTGCTTGG - Intergenic
1024169929 7:46774176-46774198 TGCAAGTCTGCCTGCCTTCTTGG + Intergenic
1024267654 7:47619123-47619145 TGCTTGTGTGTCTGCCTGCTAGG - Intergenic
1025842473 7:65163470-65163492 TGCAGGTCTGCCTGTTTTCTGGG + Intergenic
1025880572 7:65532499-65532521 TGCAGGTCTGCCTGTTTTCTGGG - Intergenic
1025892865 7:65670105-65670127 TGCAGGTCTGCCTGTTTTCTGGG + Intergenic
1025907505 7:65799133-65799155 TGGATGTCTCACCATCTGCTGGG + Intergenic
1026042314 7:66878289-66878311 TGGATGCCTCACCGTCTGCTGGG + Intergenic
1026148277 7:67767101-67767123 TGCATGTCTGGCAGTGGGCTGGG + Intergenic
1028505560 7:91566620-91566642 TGCATGTGTGCCTTTCTCCTGGG - Intergenic
1030101765 7:105953016-105953038 TGCTTGTGTGTCTGCCTGCTAGG - Intronic
1032933698 7:136704217-136704239 TGCTTGTCTGGCTTTCTTCTCGG - Intergenic
1034601105 7:152256820-152256842 TGAATGTTTGTCTGTCTTCTGGG - Intronic
1034924393 7:155109723-155109745 TGGATGTGAGGCTGTCTGCTGGG + Intergenic
1035297371 7:157874695-157874717 TGCATGAGTGTGTGTCTGCTTGG - Intronic
1036607880 8:10323799-10323821 TGCATGTCTATGTGTCTGTTTGG + Intronic
1037492430 8:19408847-19408869 TGTATTCCTGACTGTCTGCAAGG - Intronic
1037817441 8:22119699-22119721 TGCCTGTCTGCCTGTCATCTCGG - Intronic
1038346580 8:26737714-26737736 TGCATGACTCACGGGCTGCTAGG + Intergenic
1040073379 8:43205912-43205934 TGCATGTTTGCATGTGTGCTTGG - Intergenic
1041718983 8:60959409-60959431 TGCATGTCTGAGTGCCTAATGGG + Intergenic
1042159240 8:65875293-65875315 TGCTTGTATGTGTGTCTGCTAGG + Intergenic
1042471954 8:69200426-69200448 TGTATGTCAGACTTTGTGCTAGG - Intergenic
1044659347 8:94579796-94579818 TGCATATCTGATTGACTCCTTGG + Intergenic
1046277480 8:111982494-111982516 TGCCTGTGTGACTGCCTGCTAGG + Intergenic
1047166472 8:122444817-122444839 AGCATCTCTAACTCTCTGCTTGG - Intergenic
1047522090 8:125602795-125602817 TGCATGTGTGACTGAGTGTTAGG - Intergenic
1048135001 8:131739909-131739931 TGCTTGTGTGTCTGCCTGCTGGG - Intergenic
1050202191 9:3157257-3157279 TGCTTGTGTGTCTGCCTGCTAGG + Intergenic
1050894052 9:10863243-10863265 TCCATCTCTGACTTTCTTCTTGG - Intergenic
1055168931 9:73230791-73230813 TGCTTGTTTGACTGTCTGTTTGG - Intergenic
1057456128 9:95213439-95213461 TGTATGTCTGTCTTTCTGCCTGG - Intronic
1057898537 9:98929674-98929696 TGGATGCCTGGCTGTTTGCTTGG - Intergenic
1058201213 9:102043264-102043286 TGTCTGTCTGTCTGTCTGTTGGG + Intergenic
1058528600 9:105884573-105884595 TGGAGGTCTGACTGCCTGGTGGG + Intergenic
1059276460 9:113101303-113101325 TCCTTTTCTGACTGTCAGCTGGG + Intergenic
1059443408 9:114323601-114323623 TGAATCTTTGACTGTCAGCTGGG - Intronic
1059444597 9:114330372-114330394 TGAATCTTTGACTGTCAGCTGGG - Intronic
1060109056 9:120893739-120893761 TGCTTTCCTGACTGTCTGCCTGG - Intronic
1060240556 9:121898860-121898882 TGCATGTCTGGCCAGCTGCTGGG + Intronic
1061825292 9:133254667-133254689 TGCATGTCTGTGTGTCTGTGTGG + Intronic
1062736444 9:138140186-138140208 TGCATGTGTGAGTGTGTGGTGGG + Intergenic
1203585250 Un_KI270746v1:62977-62999 TGAATGTTTGTCTGTCTTCTGGG - Intergenic
1203625205 Un_KI270750v1:11429-11451 TGCTTGTGTGTCTGCCTGCTAGG - Intergenic
1186243470 X:7594429-7594451 TGCATGTCTGCATGTCTGCATGG - Intergenic
1188261810 X:28032478-28032500 AGCACATCTGACTGTGTGCTGGG - Intergenic
1188622486 X:32243054-32243076 TGCCTGTCTGCCTGCTTGCTTGG - Intronic
1190051905 X:47156817-47156839 TGCATGTCTGCTTGCCTGCTAGG + Intronic
1191741168 X:64436560-64436582 TGCATATCTGATTGTCTCCTTGG + Intergenic
1192233464 X:69281449-69281471 TGCATGTGTGACTGTGTGTGTGG - Intergenic
1192576698 X:72248491-72248513 TGCATATCTGCCTGGCTTCTTGG - Intronic
1192637390 X:72832470-72832492 TGCAGCTCCTACTGTCTGCTGGG + Intronic
1192644324 X:72888344-72888366 TGCAGCTCCTACTGTCTGCTGGG - Intronic
1193201665 X:78698434-78698456 TGCTGGTCTGACTCCCTGCTGGG + Intergenic
1193578477 X:83232608-83232630 AGCCTGTCTCACTCTCTGCTTGG + Intergenic
1193702489 X:84780098-84780120 TGCCTGTGTGTCTGCCTGCTAGG + Intergenic
1194007482 X:88513977-88513999 TACATGCGTTACTGTCTGCTAGG + Intergenic
1194007819 X:88518843-88518865 TGCATATCTGAATGCCTTCTTGG - Intergenic
1198153787 X:133937004-133937026 TGTCTGTCTGTCTGTCTGCCTGG - Intronic
1199393382 X:147307261-147307283 TGCATGTCTGAATCTCAGCAGGG + Intergenic
1200398682 X:156006275-156006297 TGCATGTGTGAGTGTGTGGTGGG + Intronic
1200975573 Y:9209099-9209121 TGCATGTCAGATTGACTGGTAGG + Intergenic
1201669099 Y:16496374-16496396 TGCAGGTATGACTGACTGCCAGG - Intergenic
1202135585 Y:21657421-21657443 TGCATGTCAGATTGACTGGTAGG - Intergenic