ID: 1077994322

View in Genome Browser
Species Human (GRCh38)
Location 11:7440161-7440183
Sequence ACAGTGATGAATGGTGTGTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 196
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 179}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077994317_1077994322 24 Left 1077994317 11:7440114-7440136 CCTGAAGACTCACCAGAACACGT 0: 1
1: 0
2: 0
3: 4
4: 90
Right 1077994322 11:7440161-7440183 ACAGTGATGAATGGTGTGTTTGG 0: 1
1: 0
2: 0
3: 16
4: 179
1077994319_1077994322 12 Left 1077994319 11:7440126-7440148 CCAGAACACGTATGGACTTGCAG 0: 1
1: 0
2: 0
3: 4
4: 53
Right 1077994322 11:7440161-7440183 ACAGTGATGAATGGTGTGTTTGG 0: 1
1: 0
2: 0
3: 16
4: 179

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077994322 Original CRISPR ACAGTGATGAATGGTGTGTT TGG Intronic
900708122 1:4093416-4093438 ACAGTTATGACAGGTGTGTTGGG + Intergenic
900981048 1:6046372-6046394 ACCGTGATGGATGGGGTGGTGGG + Intronic
901680226 1:10908800-10908822 AAAGTGATGGAGGGTCTGTTTGG - Intergenic
904918546 1:33987730-33987752 AAAGTGATGAAGAGTCTGTTTGG - Intronic
905112486 1:35606027-35606049 ACAGTGAAGAATGGAATGTAAGG + Intronic
906085210 1:43127125-43127147 ATAGTGATGAATGAGGTGTCTGG + Intergenic
906414136 1:45606480-45606502 AGAATGGAGAATGGTGTGTTGGG + Exonic
907243695 1:53094229-53094251 ACAGTGGTCAATGGTGAGTGAGG + Intronic
908718573 1:67097687-67097709 TCAGTGATGGATGGTCTGTGGGG + Intronic
910197115 1:84653115-84653137 ACAGTGATGGTTGGTTTATTAGG - Intronic
910549283 1:88457551-88457573 AGTGTGATGTGTGGTGTGTTTGG - Intergenic
911721937 1:101200625-101200647 TCAGTGATGAACGGAGAGTTGGG + Intergenic
912752471 1:112297117-112297139 ACAGTGATGAGTGCTGTGAGAGG - Intergenic
914860469 1:151381746-151381768 CCAGTGATGCTTGGTGAGTTGGG + Intergenic
914959067 1:152189942-152189964 TCAGTGATGAATGGAGTGGCAGG - Intergenic
915287322 1:154861359-154861381 ACAGTGATGGATGGAATATTTGG - Intronic
915785740 1:158609494-158609516 ACAGTGACGAATGGTTAGTAAGG + Intergenic
916299787 1:163261242-163261264 ACAGTGATGACTGGTGTGGATGG - Intronic
918227274 1:182495508-182495530 GCAGTGATGAATGGTTTGGCTGG - Intronic
918284881 1:183042478-183042500 ACAGTGATGGATGGGTTGGTGGG + Intronic
922219655 1:223548762-223548784 ATATTGAAGTATGGTGTGTTAGG - Intronic
922861162 1:228818115-228818137 ACTGTCATCAATGGTGTGTTAGG - Intergenic
923610846 1:235492044-235492066 ACAGAGATAAATAGAGTGTTAGG - Intronic
923647101 1:235834863-235834885 ACAGGTATGGAAGGTGTGTTAGG - Intronic
924329273 1:242925884-242925906 AGAGTAATGAATGCTGTCTTTGG - Intergenic
1067726114 10:48772338-48772360 ACAGGCATGTATGGTGTGTGTGG + Intronic
1072414219 10:95233378-95233400 ACAGTGGTGAATGATGTGGTTGG - Intergenic
1073721035 10:106171999-106172021 GCAGTGTTGCATGGAGTGTTGGG - Intergenic
1075205462 10:120444046-120444068 TGAGTGATGAGTGGTGTGTGGGG + Intergenic
1075435031 10:122432399-122432421 ACAATGATTAGGGGTGTGTTTGG + Exonic
1076121342 10:127939471-127939493 ACAGTGAAGAATCCTGTGTTTGG - Intronic
1077127069 11:945004-945026 AGAGTGGTGAATGGTGTGAGGGG + Intronic
1077993284 11:7431626-7431648 AGAGTGATGAATGGTTTTGTGGG + Intronic
1077994322 11:7440161-7440183 ACAGTGATGAATGGTGTGTTTGG + Intronic
1079721685 11:23822734-23822756 ACAGAGATGCATGGAGTCTTAGG + Intergenic
1084488209 11:69463466-69463488 AGAGGGAGGAAGGGTGTGTTTGG - Intergenic
1084504770 11:69558543-69558565 ACAGTGGTGAAAGCAGTGTTTGG - Intergenic
1085429289 11:76433143-76433165 ACAGTGAGCTATGTTGTGTTTGG - Intergenic
1087759494 11:102090553-102090575 ACTATGATGTTTGGTGTGTTAGG - Intergenic
1099910534 12:88827507-88827529 ACAGTGATCAATAATGTTTTGGG - Intergenic
1104228358 12:126859250-126859272 ACAGTGATGATGGGAGTGGTTGG + Intergenic
1104557384 12:129813286-129813308 ACAGTTGTGAAGTGTGTGTTTGG - Intronic
1105646515 13:22324153-22324175 ACAGGGATCACTGGTGTGTTTGG - Intergenic
1106588103 13:31074514-31074536 ACAGTGGTGAATGGCTAGTTGGG - Intergenic
1106712686 13:32355103-32355125 ACAGAGTTGAACAGTGTGTTAGG + Exonic
1107611273 13:42115605-42115627 ACAGGGAAGCATGGTGTATTTGG + Intronic
1108006021 13:45947282-45947304 ATTGTGAAGAGTGGTGTGTTTGG + Intergenic
1109281979 13:60367295-60367317 ACAGTAAGGAATGTTGTGGTAGG - Intergenic
1114182776 14:20379835-20379857 AGAGTGATAACAGGTGTGTTTGG + Intronic
1114532861 14:23406220-23406242 ACAGTGATGGATGGGGAGTGTGG - Intronic
1115101926 14:29712078-29712100 ACTGTGAAGAAAGGTGTCTTTGG + Intronic
1117941724 14:60973990-60974012 ACTGTGATGAGTGGTTTGTCTGG + Exonic
1118015482 14:61656067-61656089 ACAGAGAGGAATTGTGTGCTGGG - Intronic
1118177098 14:63451599-63451621 GCAGTGATGTATGGTATGTATGG + Intronic
1119359131 14:74033128-74033150 TCAGAGATAAAAGGTGTGTTAGG + Intronic
1119766259 14:77190244-77190266 TCAGTGATTATTGGTCTGTTGGG - Intronic
1121947279 14:98135701-98135723 AAAGTGAGGAATGGTGAATTCGG - Intergenic
1125080782 15:35670405-35670427 ACAGTGAGGAATGTGGTATTAGG + Intergenic
1125103411 15:35942458-35942480 TAAGTGATTAATGGTGTGTGAGG - Intergenic
1125615282 15:41006146-41006168 ACAGTGATGCATGCTCTGTTGGG - Intronic
1125754634 15:42054757-42054779 ACAGTGAGGACTGGAATGTTGGG + Intergenic
1126429056 15:48561098-48561120 CCAGTGATGAGTGGTCTGTCAGG + Intronic
1127534657 15:59878907-59878929 GCAGTGATGAATGGTTTATCAGG - Intergenic
1129681167 15:77659249-77659271 ACAGTGGTGCATGGTGTTCTGGG - Intronic
1131524117 15:93139162-93139184 ACAGGGATGAATGCTGTGGTGGG + Intergenic
1132380604 15:101363303-101363325 AGAGTGTTGAATGGTGTGCCCGG + Intronic
1133730415 16:8573738-8573760 ACAGTGGTGAATGCAGTGTAAGG - Intronic
1135177861 16:20246846-20246868 ATTGTGATAAATGGTGTGATTGG - Intergenic
1136077496 16:27827021-27827043 ACAGTGATGGAAGGGGAGTTGGG - Intronic
1137853480 16:51769915-51769937 AGAGTAATGAATGGGGTGTGCGG - Intergenic
1141903755 16:87009275-87009297 ACAGTGATGAATGATGGGGTTGG - Intergenic
1144146523 17:12404431-12404453 ACAGTGCTTAAAGGTGTCTTGGG - Intergenic
1147004089 17:37387734-37387756 ACAGTGAAGAAGGCTGTGTGCGG - Intronic
1148480153 17:47954737-47954759 ACACTGATGACTGGTGAGGTCGG + Intronic
1151999520 17:77636765-77636787 ACAGAGATGAAGGCTGTGTGAGG - Intergenic
1154981471 18:21505885-21505907 ACAGTGGTGAAAGGTGTTATAGG - Exonic
1155229428 18:23758300-23758322 ACCGTGATGACTCGTGTGTCAGG + Intronic
1155398649 18:25415004-25415026 ACAGTGCTAAATGCTGTGTTTGG + Intergenic
1156615574 18:38780320-38780342 ACTGTGATGTTTGGTATGTTTGG - Intergenic
1159858176 18:73614407-73614429 ACAGTGATGAGTGGGCTGATAGG + Intergenic
1165104056 19:33458385-33458407 CAAGTGATGTATGGTGTGTGTGG + Intronic
1165751619 19:38264032-38264054 AAAGTGATGAAAGCTGTGATGGG - Intronic
1166626244 19:44358794-44358816 AGAGTGAAGAATGGTGGGTTTGG - Intronic
1167856230 19:52242885-52242907 ACACAGCTGAATGGTCTGTTAGG - Intergenic
925999943 2:9322669-9322691 ACAGTGATGAGCGGTGTTGTAGG + Intronic
931084391 2:58813085-58813107 ACAGTGATAAATAATGTATTGGG + Intergenic
936037311 2:109123284-109123306 ACAGTGAGGAAGGCTGAGTTGGG - Intergenic
942050163 2:172132427-172132449 GCAGTAATGAAAGGAGTGTTGGG + Intergenic
943630760 2:190249140-190249162 ACAATTTTGAATGGTGTTTTAGG + Intronic
946354345 2:219175719-219175741 GCAGTGGGGACTGGTGTGTTGGG - Intronic
946880866 2:224176021-224176043 AGAGTTAAGAAGGGTGTGTTTGG + Intergenic
947574737 2:231264059-231264081 CCTCTGATGAAAGGTGTGTTGGG + Intronic
947930951 2:233964766-233964788 ACAGTGTGGAATGCTGTGGTGGG + Intronic
1171876110 20:30578357-30578379 AGAGTGAAGAATGGTGGGTTTGG + Intergenic
1174757432 20:53173808-53173830 ACAGTGATGATTTGGGGGTTGGG + Intronic
1175372241 20:58499761-58499783 ACAGGGATGGGTGGGGTGTTTGG - Intronic
1176752233 21:10700180-10700202 ACAGAAATGAATGGAGTGGTGGG - Intergenic
1177505326 21:22012524-22012546 ACAGTGTTGGATGGGGTGGTTGG - Intergenic
1181373481 22:22437483-22437505 ACAGTGTTGGCTGGGGTGTTTGG - Intergenic
1182563289 22:31178918-31178940 AGAGTGCTGAATATTGTGTTAGG + Intronic
1183958961 22:41399445-41399467 ACTGTGATGAAGGGGGTGTCTGG - Intergenic
949177429 3:1082081-1082103 CCAGTGGTGAATGGTTTGTCTGG + Intergenic
949990089 3:9571518-9571540 ACAGTTAAGAATGGTGTTTGAGG - Intergenic
952374670 3:32756135-32756157 AGAGTGATGAGAGGTGAGTTGGG + Intronic
953897930 3:46816691-46816713 GCAGTGATGAATGGCTTGTCTGG + Intergenic
954744321 3:52778475-52778497 TCACTGATGAATGCTGTCTTGGG - Exonic
955712849 3:61798307-61798329 ATAGTGGTGAAGTGTGTGTTGGG - Intronic
955746648 3:62147238-62147260 ACAGTGTGGAATGGAGTCTTGGG + Intronic
956478154 3:69645492-69645514 ACAGTGTACAATGCTGTGTTGGG + Intergenic
957399752 3:79694400-79694422 ACAGTGATGTATGCTGTGAAAGG + Intronic
958578404 3:95984207-95984229 ACAGTATTGAATGTTGTGGTTGG + Intergenic
961136509 3:124516666-124516688 ACAGTGAATTATGGTGTGTGTGG + Intronic
964073876 3:152669394-152669416 ACAGTGATAATTGCTGTCTTTGG + Intergenic
964554642 3:157922909-157922931 CCTGAGATGCATGGTGTGTTTGG - Intergenic
964624234 3:158744033-158744055 ACAGTGCTGATTTGTGTGTGTGG + Intronic
965347041 3:167564121-167564143 AAACTGATGAATAGTATGTTGGG - Intronic
967420549 3:189267712-189267734 ACAGTGTTGAATGGTAAGATAGG + Intronic
968544779 4:1193319-1193341 CCAGTGATGAAGGGTGTGTGGGG - Intronic
969045386 4:4332886-4332908 AGAGTGATGAATGCAGTGTCTGG + Intergenic
969170405 4:5357827-5357849 ACAGTGATGGGAGGTGTGGTGGG - Intronic
969942264 4:10745769-10745791 ATAGTGATGATTTCTGTGTTTGG - Intergenic
970244851 4:14050063-14050085 GCAGTGATGAATCATGTGTTTGG + Intergenic
978338232 4:107692980-107693002 ACACTGATGACTGTTGTGGTTGG + Intronic
978427794 4:108600305-108600327 AAAGTAATGATTGGTGTGCTGGG + Intergenic
978977141 4:114891688-114891710 ACTGTGATTAATGCAGTGTTTGG - Intronic
979618033 4:122767093-122767115 AGTGTGATGTATGGTGTGGTGGG + Intergenic
980674296 4:136054673-136054695 ACAGTGATAAATTGTATTTTTGG - Intergenic
981865084 4:149407729-149407751 ACAGTGATGAACAGTCAGTTTGG + Intergenic
983689695 4:170453226-170453248 ACTGAGGTGAATGGTGTCTTGGG - Intergenic
984086981 4:175325505-175325527 CCAGTGCTGAATGGTGTTCTTGG + Intergenic
985326689 4:188778523-188778545 ACAGTGAGAAATGGTGCGGTTGG + Intergenic
988263040 5:28913192-28913214 ACAGTGATCAAAGGGGAGTTAGG + Intergenic
988842122 5:35093299-35093321 ACAGTGGGGAGTGGTATGTTGGG - Intronic
989033046 5:37139339-37139361 GCAGTGATGAATTGTGTGAGAGG - Exonic
990027703 5:51215264-51215286 ACTGTAATGAATGGTGTATTGGG - Intergenic
990035579 5:51314380-51314402 TCATTGATGAATAGTGTCTTTGG + Intergenic
990795266 5:59532797-59532819 ACCCTGAGGAATGGTATGTTTGG - Intronic
991986611 5:72293878-72293900 TCTGTGATGAAGGGTGTATTTGG - Intronic
992714400 5:79495463-79495485 ATAGAGATGTATGTTGTGTTTGG - Intronic
992762066 5:79959291-79959313 ACAGTGCTGAATTGTCTTTTTGG - Intergenic
993935605 5:93997744-93997766 ACAGTGCAGAAAGTTGTGTTTGG - Intronic
998764783 5:145474009-145474031 ACAGTGAAGAAAAGTGTTTTTGG + Intronic
999735580 5:154510634-154510656 ACAGTGAGGAAGGGTAAGTTAGG + Intergenic
999880506 5:155858650-155858672 AAAGTGGTGTATGGTGTTTTTGG + Intergenic
999974481 5:156897200-156897222 ACAGTGGTGAATGTTGTGAAGGG - Intergenic
1002427961 5:179186850-179186872 GTAGTGAAGAATGGTGTGTGTGG - Intronic
1004031553 6:11874974-11874996 ACAGTGATGAAATGTGTTTCAGG + Intergenic
1004412481 6:15393717-15393739 ACAGTGATTACTGGTATATTGGG + Intronic
1008375151 6:50782939-50782961 ACTGTGATGAATGGTGGTGTGGG - Intergenic
1009790024 6:68390620-68390642 TCAATGATGAATTGTGTCTTAGG - Intergenic
1014818297 6:125958385-125958407 ACAATGTTTAATGGTGGGTTGGG + Intronic
1017706058 6:157123642-157123664 TCACTGATGAATGGTTTGTAGGG + Intronic
1018918884 6:168157000-168157022 ACAGTGATGTATGTGTTGTTAGG - Intergenic
1020760146 7:12258854-12258876 ATGGTGATGAATGGTGTGAATGG - Intergenic
1021509637 7:21421784-21421806 ACATTGATGAATTCAGTGTTTGG + Intergenic
1023637179 7:42224100-42224122 AAATTGATGAATGATGAGTTAGG - Intronic
1024024967 7:45402180-45402202 ACAGTGAGGATTGGCCTGTTTGG - Intergenic
1024456282 7:49611410-49611432 AGAGTGCTGAAGGTTGTGTTTGG + Intergenic
1026365667 7:69645922-69645944 ACAGTGATGACTGGTGGCCTGGG + Intronic
1028209494 7:88055759-88055781 AGCGTTATGAAAGGTGTGTTAGG - Intronic
1028418538 7:90606797-90606819 AGAGTGATGAATTAGGTGTTAGG + Intronic
1028493956 7:91443666-91443688 AGAGTCCTGAATGGTGAGTTTGG + Intergenic
1030933197 7:115551205-115551227 ACAGTGGGGAAAGGTGGGTTTGG - Intergenic
1030976931 7:116138062-116138084 GCAGAAATGAATGTTGTGTTTGG - Intronic
1031724115 7:125215747-125215769 GAAGGGATGAATGGTGTATTGGG + Intergenic
1037714724 8:21387553-21387575 TCAGTCATGAATGTTGTGGTGGG - Intergenic
1037775427 8:21832537-21832559 ACAATGAGGAATGGTGTTTGGGG - Intergenic
1038120836 8:24612814-24612836 GCAGTGGTGAGTGTTGTGTTGGG + Intergenic
1039781890 8:40794343-40794365 ATAGTGCTATATGGTGTGTTGGG - Intronic
1040959778 8:53019326-53019348 CCAGTGAGGAAGGGTGTGTCAGG - Intergenic
1041985335 8:63916044-63916066 ACAGGGATGACTGGCGCGTTTGG - Intergenic
1042309123 8:67362749-67362771 GGAGTTATGAATGGTATGTTAGG - Intergenic
1043061850 8:75515584-75515606 ACAGTGGTGTAAGGTCTGTTTGG + Intronic
1044141373 8:88657798-88657820 CCAGCGATGAATGAAGTGTTAGG - Intergenic
1046505606 8:115134336-115134358 ACAGGAAGGACTGGTGTGTTTGG - Intergenic
1046528924 8:115418637-115418659 ACAGTGATGGATGAGGTGTGTGG + Intronic
1046953173 8:120037493-120037515 ACTGTGACAAATGGTGTGTGGGG + Intronic
1047456609 8:125019019-125019041 ACTGTGATGGAAGGTGTTTTTGG + Intronic
1048192312 8:132301087-132301109 AGAGTGATGAATCGTGGGGTAGG - Intronic
1049514261 8:143045124-143045146 GCAGAGGTGACTGGTGTGTTTGG - Intronic
1051411376 9:16793368-16793390 ACCTTGATGAAAGGTGTGATGGG - Intronic
1051490898 9:17663278-17663300 ACTGTGATGATTGTTATGTTGGG + Intronic
1051595520 9:18821162-18821184 TCAGTGATGGGTGGTGTATTAGG + Intronic
1056957465 9:91093520-91093542 ACAGAGAGAAATGGTGTGTTTGG + Intergenic
1059651505 9:116319920-116319942 ACTTTCATGAATGGTGTCTTAGG + Intronic
1060070732 9:120544779-120544801 ACAGTGATGGAGGGTGTTGTGGG - Intronic
1061963386 9:133999208-133999230 ACAGGGATGAATGGAGGGATGGG - Intergenic
1061985836 9:134129719-134129741 ACAGTGATGAAGTGTTTCTTTGG - Intergenic
1203349294 Un_KI270442v1:62443-62465 ACAGAAATGAATGGAGTGGTGGG + Intergenic
1186581934 X:10828990-10829012 AGAGCAATGAATGGTGGGTTTGG - Intronic
1186733185 X:12432356-12432378 GCAGTGATAAATGTTGTTTTAGG - Intronic
1187036194 X:15542610-15542632 AGAGTGGGGAATGCTGTGTTTGG + Intronic
1188956656 X:36441822-36441844 ACTGTGATGTATGGTAGGTTAGG - Intergenic
1190088207 X:47414714-47414736 ACAGTCAAGAAGGGTGGGTTTGG - Intergenic
1195262736 X:103149535-103149557 ACTGTGAAGAATGGTTTGTCTGG + Intergenic
1199045425 X:143164641-143164663 ACTGTAATGTATGTTGTGTTTGG - Intergenic