ID: 1077995662

View in Genome Browser
Species Human (GRCh38)
Location 11:7450030-7450052
Sequence AACATTGGATTATTATTCAT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 250
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 235}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077995662_1077995666 22 Left 1077995662 11:7450030-7450052 CCGATGAATAATAATCCAATGTT 0: 1
1: 0
2: 2
3: 12
4: 235
Right 1077995666 11:7450075-7450097 CACTGTGCTCAGTGCTGTACAGG 0: 1
1: 0
2: 10
3: 57
4: 348

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077995662 Original CRISPR AACATTGGATTATTATTCAT CGG (reversed) Intronic
904792338 1:33032856-33032878 GAAATTGGATTATTTTTCCTGGG - Intronic
908662031 1:66447164-66447186 ATCATTGGATTATAGGTCATTGG - Intergenic
908879360 1:68713152-68713174 AACATTCCATTCTCATTCATAGG + Intergenic
909926531 1:81444109-81444131 AAAAAGGGATTATTATACATTGG - Intronic
910341857 1:86197601-86197623 CACATGGTATTATTAGTCATGGG - Intergenic
911444878 1:97979159-97979181 AAGATTTGATCATTATTAATTGG - Intergenic
912908944 1:113736895-113736917 AACTTTGGATTTTTATTCTAAGG + Intronic
913160558 1:116141551-116141573 CACAGTGGAATATTATTTATTGG - Intergenic
913263104 1:117018711-117018733 AACATTGAGTTAGTATGCATGGG + Intronic
916164205 1:161950497-161950519 AACATTGGTTTAGTTTTTATGGG + Intronic
917464442 1:175262830-175262852 AACTTTGGATCATTTTTCTTGGG - Intergenic
917529676 1:175823426-175823448 AAAATGGGCTTATTATTCACTGG - Intergenic
919413754 1:197280351-197280373 AGCAATAGATTATTATTCACAGG - Intronic
921429837 1:215052706-215052728 AACCTTGGATTAGAAGTCATGGG + Intronic
922938860 1:229443544-229443566 AACCTTGCATTATATTTCATAGG - Intronic
923055473 1:230423577-230423599 AACAATGGAATATGATTTATGGG - Intronic
924836049 1:247648578-247648600 CACATATGATTATTATTCACTGG + Intergenic
1063135333 10:3211565-3211587 ATCAATTGATTATTGTTCATGGG + Intergenic
1063830752 10:9949662-9949684 AACAGGGGATTATTTTTCAGGGG - Intergenic
1064828319 10:19431165-19431187 AAAATTGGTTTACTGTTCATGGG - Intronic
1064851395 10:19712979-19713001 AACATTGGAGTATAATGGATTGG - Intronic
1068417941 10:56749262-56749284 AACATTTGATCATTAAACATTGG + Intergenic
1069507771 10:69017132-69017154 AACATTAAAATATCATTCATGGG + Intergenic
1070274146 10:74988487-74988509 TACATTGACTTTTTATTCATAGG + Intronic
1070399768 10:76043385-76043407 AACATTTAATTATGATTCAGTGG - Intronic
1072104043 10:92257088-92257110 AACTTTGTATTATTAAGCATAGG - Intronic
1072851347 10:98896270-98896292 AAGATTGGCTAATTATACATTGG + Intronic
1075804481 10:125175764-125175786 AACCTTGCCTTGTTATTCATGGG - Intergenic
1077995662 11:7450030-7450052 AACATTGGATTATTATTCATCGG - Intronic
1078401550 11:11032305-11032327 AATTTTTGCTTATTATTCATAGG + Intergenic
1079562459 11:21839307-21839329 CATATTGAATTATTATTCAGTGG + Intergenic
1080095539 11:28401878-28401900 AACATTATAATATTTTTCATAGG - Intergenic
1080129918 11:28781991-28782013 AAGATTTGATTATTGTTTATTGG - Intergenic
1081300688 11:41447408-41447430 AAGATTGGATTATTTTTCATGGG - Intronic
1087999820 11:104864351-104864373 AACAATAGACTATTATTCAGTGG + Intergenic
1090298957 11:125617193-125617215 AAGATAGTAATATTATTCATTGG + Intronic
1090671833 11:128953010-128953032 AAAATAGGAAGATTATTCATGGG - Intergenic
1093521452 12:20055661-20055683 TAGATTAGATTAGTATTCATCGG + Intergenic
1093594632 12:20945934-20945956 ACCATTTCATTATCATTCATGGG - Intergenic
1096260967 12:50091235-50091257 AACATTACATTACTGTTCATGGG - Intronic
1097549709 12:61051958-61051980 AAAATTTGATTATTGTACATTGG + Intergenic
1097793183 12:63836474-63836496 AAGATTGTATTATTACTCAGAGG - Intergenic
1098302387 12:69067431-69067453 AACACTGGCTTACTATTCACAGG - Intergenic
1099775573 12:87123802-87123824 TACAATGGACTATTATTCAGTGG - Intergenic
1100112271 12:91259998-91260020 AGCAATGGTTTATAATTCATTGG + Intergenic
1105745126 13:23370513-23370535 AACACAGTATTGTTATTCATGGG + Intronic
1108744929 13:53383402-53383424 AACTGTGTATTATTATTTATGGG - Intergenic
1108974047 13:56414235-56414257 AAAATGAAATTATTATTCATAGG + Intergenic
1109072831 13:57790121-57790143 AAAAAGTGATTATTATTCATTGG - Intergenic
1109644050 13:65229375-65229397 AACATTTAATTCCTATTCATAGG - Intergenic
1110564393 13:76943625-76943647 AACATTGAGTGATTATCCATGGG - Intergenic
1110746049 13:79054544-79054566 AACATTCGTTTATTATAAATTGG - Intergenic
1112788410 13:102977130-102977152 AACATTGCATTACGATCCATTGG + Intergenic
1112798342 13:103082487-103082509 AAGATTCTATTATTATTCTTTGG - Intergenic
1112911843 13:104494952-104494974 AACATTGCATGCTCATTCATAGG - Intergenic
1113050189 13:106202598-106202620 ATCATTAGTTTATTATTCAAAGG + Intergenic
1114232643 14:20798157-20798179 AAGATTGGCTTATTTTTTATGGG - Intergenic
1114725090 14:24927947-24927969 AACATTGGATAGTAATTCAAAGG - Intronic
1114747183 14:25161993-25162015 AACATTTGATTTTTTTTCCTTGG + Intergenic
1115054465 14:29105948-29105970 AACACTGGATTATCATTCATAGG - Intergenic
1115488360 14:33934886-33934908 AACAATGGATTTTCATTTATTGG - Intronic
1117185713 14:53238415-53238437 AACATTGGCTTCTTATTGTTAGG + Intergenic
1117300791 14:54424950-54424972 AAGTTTGAATTATTTTTCATGGG - Exonic
1119372972 14:74163725-74163747 CACTTTGTATTATTTTTCATAGG - Intronic
1120863452 14:89275525-89275547 AACACTGGATTATGAGTCAAGGG - Intronic
1121164660 14:91780809-91780831 GAGATTGGATTTTTATTTATAGG + Exonic
1122332831 14:100936447-100936469 ATCATTCATTTATTATTCATTGG - Intergenic
1124717737 15:32081523-32081545 AACAATAGAGTATTACTCATTGG - Intronic
1125176996 15:36834916-36834938 AAAATTGGATTATTTTACAATGG - Intergenic
1135888112 16:26331943-26331965 TACAATGGACTATTATTCAATGG + Intergenic
1136519824 16:30788028-30788050 CACACTGCATTATTATTCCTGGG + Intergenic
1137372427 16:47920162-47920184 AACATTAGATTATTACTTTTGGG + Intergenic
1137794799 16:51206875-51206897 AACATTGGAATATTTTCCAGGGG - Intergenic
1138518261 16:57551731-57551753 AACATGTGATTGTGATTCATGGG - Intronic
1141716153 16:85728195-85728217 AACAATGGATTTGTATTGATTGG + Intronic
1143738841 17:8936610-8936632 TACAATGGAATATTATTCAGTGG - Intronic
1146540303 17:33687697-33687719 AAGAGAGGATAATTATTCATTGG + Intronic
1148357835 17:46987774-46987796 TACAATGGAATATTATTCATAGG + Intronic
1149148068 17:53522439-53522461 AAAAGAGGATTATTATTTATTGG + Intergenic
1153194600 18:2580612-2580634 AAACTTGGATTTTTATTAATGGG - Intronic
1155440582 18:25857758-25857780 AACATTGAGATATTACTCATGGG + Intergenic
1155817709 18:30334870-30334892 AACTTGGGATTTTTATACATTGG + Intergenic
1156062259 18:33093595-33093617 AACTTTGCATCACTATTCATTGG + Intronic
1156588680 18:38461373-38461395 AACATTGGCCTCTTATTGATTGG - Intergenic
1157327019 18:46676749-46676771 CCCATTGAATTATTATTCAAGGG - Intronic
1158267937 18:55680737-55680759 AAGAATGGGTTAATATTCATAGG - Intergenic
1158445065 18:57512326-57512348 AATATTGTATTATCATTCATGGG - Intergenic
1159977028 18:74726705-74726727 GACATTGAATTATGAATCATAGG + Intronic
1160012719 18:75118665-75118687 CACATTGGATTTATTTTCATGGG - Intergenic
1160339316 18:78073978-78074000 AATACTGGATTATTTTTCAATGG + Intergenic
1164331105 19:24257562-24257584 AACATTGGGTTTTTCATCATAGG + Intergenic
925471481 2:4166133-4166155 AACAATGGAAAATTATTCAGAGG - Intergenic
927309095 2:21608273-21608295 AACATTGGCTTGGTATACATGGG - Intergenic
928706328 2:33953517-33953539 CACAATGGAATATTATTCAAAGG + Intergenic
929646584 2:43634615-43634637 TACAATGGAATATTATTCAGTGG - Intergenic
929897864 2:45977256-45977278 TTCAGTGGATTATTATTCAGTGG - Intronic
930482714 2:51969753-51969775 AGTATTGTATTATTATTCAAAGG - Intergenic
930967653 2:57350613-57350635 AGCATTGGATTATAACTCAAAGG + Intergenic
931665106 2:64604866-64604888 AGAATTGGATTATTAGCCATAGG - Intergenic
932557486 2:72837829-72837851 AACATGGGATAAACATTCATTGG - Intergenic
933804502 2:85988445-85988467 AGCCTTGGATTATTTTTCCTGGG + Intergenic
934072379 2:88396378-88396400 AATATTGCATCATTACTCATAGG + Intergenic
937420414 2:121749905-121749927 AACATTCAACTATTATTAATGGG + Intronic
938656242 2:133436981-133437003 AACATTGTCGTATTTTTCATTGG + Intronic
939263766 2:139845044-139845066 AACAGTATATTATTATTCAGAGG + Intergenic
939405829 2:141754488-141754510 AATATGGTATTATTATGCATTGG - Intronic
939787475 2:146535490-146535512 AACCTTGGAAGATAATTCATTGG + Intergenic
941280621 2:163546112-163546134 ATCATTGGTTTATTACACATAGG - Intergenic
941352529 2:164454411-164454433 AACATTGCATAAATATTAATAGG + Intergenic
941856508 2:170236327-170236349 AACATGGTCTTATTATTCCTTGG - Intronic
941967019 2:171310717-171310739 AACATAGGGATATTATTTATTGG + Intergenic
942235674 2:173902284-173902306 AAAATTTCATTGTTATTCATTGG + Intergenic
942373366 2:175310186-175310208 CATATTGGATAATTATTTATTGG + Intergenic
942527477 2:176870037-176870059 AACAATGCATTATTTTTCTTTGG + Intergenic
943722009 2:191214626-191214648 AATATTGGATTATTTTTAAAAGG + Intergenic
944629006 2:201603515-201603537 AATAATGAATTATTATTCTTTGG - Intronic
945154999 2:206829066-206829088 AATATAGGATTATTAGTTATAGG - Intergenic
945561889 2:211349692-211349714 TAGATTTAATTATTATTCATTGG + Intergenic
945610856 2:212001098-212001120 AATATTGGATTATTTTTAACAGG + Intronic
947095390 2:226561291-226561313 AAAACTCGATTATTATACATTGG + Intergenic
1171222856 20:23416558-23416580 ATAATTATATTATTATTCATGGG - Intronic
1171240233 20:23561725-23561747 AAAATTGTATTATAATGCATTGG + Intergenic
1175608124 20:60328136-60328158 AACAAAGGCTTATTACTCATGGG + Intergenic
1177523088 21:22255658-22255680 AATACTTGAGTATTATTCATAGG + Intergenic
1177954863 21:27585080-27585102 GAAAATGGATTATTCTTCATTGG - Intergenic
1178909410 21:36662229-36662251 AACTTTAGATTAATATACATGGG + Intergenic
1182989248 22:34751352-34751374 AACATTGCTTTATTATACGTTGG + Intergenic
949184559 3:1174750-1174772 AATTTAGCATTATTATTCATTGG - Intronic
949730093 3:7100460-7100482 AAAATTGGATAGTTTTTCATAGG + Intronic
951002279 3:17576603-17576625 AACACTGTATTTCTATTCATAGG + Intronic
956465635 3:69518283-69518305 AACAATGTATTCTTATACATTGG + Intronic
957187894 3:76966507-76966529 AACATTGGAGTCTTAATCATCGG + Intronic
959200733 3:103243205-103243227 AACATTCCATTTTTCTTCATTGG - Intergenic
959282186 3:104358388-104358410 AATATTTGACTATTATTCATTGG + Intergenic
959396850 3:105851177-105851199 CACAATGGAGTATTATTCAGTGG + Intronic
961348759 3:126285348-126285370 AGCAATGGACTATTATTCAAAGG - Intergenic
961970603 3:130961201-130961223 AACATTGACATATTATCCATTGG + Intronic
964017953 3:151970936-151970958 AACATTGCTTAATTATTCAAAGG + Intergenic
966562344 3:181336957-181336979 GACAATGGAATATTATTCAATGG + Intergenic
967711450 3:192712213-192712235 TATTTTGGATTATTTTTCATAGG - Intronic
967764697 3:193266047-193266069 AACATAGTATCATTAATCATAGG - Intronic
968470506 4:780083-780105 AGCATTGGATTATAATGCACAGG - Intergenic
971313201 4:25544269-25544291 AACATTTGATTTATTTTCATTGG + Intergenic
974166442 4:58210877-58210899 ACCATTGAATTATTTTTCATGGG + Intergenic
974453640 4:62097847-62097869 AAGTTTGTATTATTTTTCATAGG - Intergenic
974689977 4:65285866-65285888 AAGCTGAGATTATTATTCATAGG - Intergenic
974736719 4:65945091-65945113 CCCATTGGATTATGTTTCATTGG + Intergenic
975011640 4:69362137-69362159 AACATTGCATTTATATTAATTGG + Intronic
977132238 4:93254821-93254843 GAAATTGGATAATTATTCTTGGG + Intronic
978405750 4:108377037-108377059 GACCTGGGATTATTATTCTTTGG + Intergenic
978516724 4:109576759-109576781 AACCTTGGACTACTATTGATGGG + Intronic
978677289 4:111334488-111334510 CTCATTGGATTGGTATTCATTGG - Intergenic
980287629 4:130801048-130801070 AACTTTTCATTATTATTGATTGG - Intergenic
981112195 4:140948420-140948442 AGCATTGGATTACAATACATGGG - Intronic
981270238 4:142837955-142837977 AACAATTGATAATAATTCATAGG + Intronic
982719286 4:158842778-158842800 AACATTGGCTTTTTATTAAAGGG + Intronic
982791424 4:159596165-159596187 AAAAGTGAATTATTTTTCATGGG - Intergenic
983447012 4:167864793-167864815 AACATTCCTTTATTATTCTTTGG - Intergenic
983809104 4:172035769-172035791 AACAGTGCTTTAATATTCATGGG + Intronic
983918913 4:173323949-173323971 AATATTGTATTTTAATTCATGGG + Exonic
984157878 4:176213680-176213702 AAAGTGTGATTATTATTCATTGG - Exonic
984282519 4:177688839-177688861 AACATCCTATTATTAATCATTGG - Intergenic
984576584 4:181455509-181455531 AATATTAGATTAGTATTCAAGGG + Intergenic
985059691 4:186064860-186064882 AACATTGGTTTCTTTTTCAGAGG + Intergenic
987165181 5:15190592-15190614 AACAGTGGATTATTATCTATTGG + Intergenic
987587777 5:19879077-19879099 TAGATTAGAGTATTATTCATTGG - Intronic
988162189 5:27532975-27532997 AGCATTGCATAATTATTAATAGG - Intergenic
989490196 5:42041981-42042003 AATATTGCTTTATTATTCAAAGG - Intergenic
990807588 5:59683101-59683123 AACATGGAATTATCATACATAGG - Intronic
992185948 5:74244792-74244814 AACATTGCATTACTGTTCATTGG - Intergenic
993942137 5:94072009-94072031 GACAATGGAATATTACTCATCGG + Intronic
993942485 5:94076826-94076848 ACTATTAGATTATTTTTCATTGG + Intronic
994294494 5:98074129-98074151 AACATTTGATTATCTTTCAGAGG + Intergenic
994797722 5:104326505-104326527 AATATTGTAATATGATTCATGGG - Intergenic
995610567 5:113906124-113906146 CACATTGTATTATTATTTTTAGG + Intergenic
996173552 5:120326484-120326506 AAGATTGGATTAGTTTTCGTGGG + Intergenic
996341024 5:122439064-122439086 AACACTGGATTACTTTTAATTGG - Intronic
998982018 5:147714759-147714781 GACAGTGGAATATTTTTCATAGG + Intronic
999168684 5:149574274-149574296 AATATTTGATTTTTATTTATTGG - Intronic
1000138108 5:158373395-158373417 TACAGTGGAATATTACTCATCGG + Intergenic
1000808229 5:165824872-165824894 AAGATGAAATTATTATTCATGGG + Intergenic
1000958327 5:167569444-167569466 CACATTGGTTTATTATTACTTGG - Intronic
1001188083 5:169597027-169597049 AGCAATGGATTATAACTCATAGG - Intronic
1003440829 6:6140004-6140026 AACATTGGACGAATGTTCATAGG + Intergenic
1005085729 6:22004960-22004982 AAAGTTTGATTACTATTCATGGG - Intergenic
1005369880 6:25121330-25121352 AAAATTAGATAAATATTCATAGG + Intergenic
1006606385 6:35260129-35260151 AACCGTTGGTTATTATTCATTGG + Intronic
1006710176 6:36061890-36061912 AACAATGGAATATTTTTCTTAGG - Intronic
1007503724 6:42318193-42318215 TAGAGTGGATTATTATTCAATGG - Intronic
1008082141 6:47205667-47205689 AACATTCAATTACTATTCCTTGG + Intergenic
1008119846 6:47599807-47599829 AGCATTAGATTATATTTCATAGG + Intronic
1009956122 6:70455845-70455867 AAAAATGAATTAATATTCATAGG - Intronic
1010751439 6:79620166-79620188 AACATTAGTTTATTATTCCAGGG - Intergenic
1012798088 6:103789332-103789354 AACAATGGATTAATAATTATGGG + Intergenic
1012991319 6:105929553-105929575 CACATTTGATTATTATTTACAGG - Intergenic
1014510990 6:122322089-122322111 AAGATGAGATTATTATGCATAGG + Intergenic
1016135648 6:140538703-140538725 AACATAGGACTATTTTTCAATGG - Intergenic
1016834603 6:148464825-148464847 AACATGGGCTTGTTATTCTTTGG + Intronic
1017485988 6:154902185-154902207 AACATTGGATTAATAACCAGTGG - Intronic
1018245623 6:161820196-161820218 ACCATTGAATTTTTATTCAATGG - Intronic
1020682181 7:11251030-11251052 ACCATGGAATTATTAATCATGGG + Intergenic
1021502480 7:21346086-21346108 AATATTGGATTATAAGTCAGGGG + Intergenic
1023309868 7:38874597-38874619 AACATTGGATATTTATTAAAAGG - Intronic
1023667972 7:42544399-42544421 AAAATTGGATTAATATTTTTAGG - Intergenic
1024769648 7:52705699-52705721 AGTATTGGATTATAATTCAAGGG + Intergenic
1027689867 7:81331063-81331085 AAAATTGGATTTATATTCAGGGG - Intergenic
1027972351 7:85101337-85101359 AATAATTGAATATTATTCATAGG - Intronic
1028330513 7:89584972-89584994 AAATTTGGTTTATTATTCATTGG + Intergenic
1028701137 7:93781812-93781834 TACAATGGGATATTATTCATTGG + Intronic
1030219399 7:107081202-107081224 AACATTGTATTGTTATTTGTGGG + Intronic
1032616212 7:133474070-133474092 TACATTGTGTTATTATTGATAGG + Intronic
1038079118 8:24112435-24112457 AACATTGAATTAGAATACATTGG - Intergenic
1040134960 8:43842457-43842479 AATATTGGATTTTTCCTCATAGG - Intergenic
1042075610 8:64991290-64991312 AATATTTAACTATTATTCATGGG - Intergenic
1042097117 8:65228986-65229008 AACATTGTATTTTTATTATTGGG - Intergenic
1042832263 8:73044033-73044055 AACAGTGGGTTATTAATCTTTGG - Intronic
1043073570 8:75667625-75667647 AACTTTTGGTAATTATTCATGGG + Intergenic
1043339138 8:79216340-79216362 AACATGAGATAATTATTAATAGG - Intergenic
1044063252 8:87665425-87665447 AACAGTGTTTTGTTATTCATTGG - Intergenic
1044800248 8:95946161-95946183 CACATTGGAATATAATTTATCGG + Intergenic
1046199655 8:110907987-110908009 AAAATTGTATTGTTATGCATCGG + Intergenic
1046238239 8:111456002-111456024 GACATTGTATTAATATGCATAGG + Intergenic
1046622998 8:116547571-116547593 AATATTTGATTATTATGCAGGGG - Intergenic
1051051884 9:12943551-12943573 AAAATTGAATTGTTATTCATTGG + Intergenic
1051271317 9:15358061-15358083 TACATAGGAATATTATTCATAGG - Intergenic
1051653718 9:19356687-19356709 AAAATTGGAATATCATTTATTGG + Intronic
1053373589 9:37584660-37584682 AAAATGGCATTATTATTGATTGG + Intronic
1056211780 9:84371592-84371614 AACATTCCATGCTTATTCATAGG - Intergenic
1058027616 9:100159516-100159538 AACATTGCTTTATTATAGATAGG + Intronic
1058920108 9:109605736-109605758 AACATTGCAGTGTTATTAATTGG - Intergenic
1059553335 9:115252538-115252560 AAAAATAAATTATTATTCATGGG - Intronic
1060731853 9:126043239-126043261 AACATTGGATTAGAAGTCCTAGG - Intergenic
1185962987 X:4566007-4566029 AAAATTGGCTTATTATTTAAAGG + Intergenic
1186058491 X:5677766-5677788 AACATGGAATTATTATTCAAGGG - Intergenic
1186337906 X:8610920-8610942 CACACTGGATTATTTTTGATTGG - Intronic
1188187889 X:27138239-27138261 AACATTGTATTATAGATCATTGG + Intergenic
1190853012 X:54265042-54265064 AACATTGGATAATTCATTATGGG + Intronic
1192875744 X:75227616-75227638 GACATTGAATTCTTTTTCATGGG + Intergenic
1193750870 X:85341863-85341885 CAAATTGGAGTATTTTTCATTGG + Intronic
1194171072 X:90582746-90582768 AAGATGTGATTATTATTCTTAGG - Intergenic
1194542131 X:95187466-95187488 TAAATTGGAATATTATTCAGAGG - Intergenic
1196150555 X:112368875-112368897 AACATCTGGTTATTATTAATTGG - Intergenic
1197925637 X:131644585-131644607 GAAATTGGATTATTATTATTGGG - Intergenic
1198368112 X:135963607-135963629 AGCATGAGATTATTTTTCATTGG - Exonic
1199420860 X:147643310-147643332 AACATTGGCTCATTTTTAATTGG - Intergenic
1199475886 X:148244663-148244685 AATATTGGATTATAACTCAGAGG + Intergenic
1200517304 Y:4160493-4160515 AAGATGTGATTATTATTCTTAGG - Intergenic
1201537055 Y:15061358-15061380 AACATTGAATTATTATTCCAGGG + Intergenic
1201753342 Y:17459142-17459164 AACAGTGCATAATTATTCCTTGG - Intergenic
1201848211 Y:18446841-18446863 AACAGTGCATAATTATTCCTTGG + Intergenic