ID: 1077996221

View in Genome Browser
Species Human (GRCh38)
Location 11:7454612-7454634
Sequence CCCCGTAGGCAGTTTCCTAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 50
Summary {0: 1, 1: 0, 2: 1, 3: 2, 4: 46}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077996221_1077996224 30 Left 1077996221 11:7454612-7454634 CCAATAGGAAACTGCCTACGGGG 0: 1
1: 0
2: 1
3: 2
4: 46
Right 1077996224 11:7454665-7454687 ACAGCCTCTCATTCTGAGATTGG 0: 1
1: 0
2: 0
3: 61
4: 198

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077996221 Original CRISPR CCCCGTAGGCAGTTTCCTAT TGG (reversed) Intronic
902395753 1:16131820-16131842 CCCCGGAGGCCATTTCCTACCGG - Exonic
905042690 1:34973337-34973359 CCTAGTAGTCAGTTTCCTTTGGG - Intergenic
911987687 1:104650814-104650836 CTCAGTAGGCAATTTCATATTGG + Intergenic
916620406 1:166490418-166490440 CCCCTTAGGGAAGTTCCTATTGG + Intergenic
920957456 1:210632572-210632594 CCCCATAGCCTCTTTCCTATTGG + Intronic
1067794996 10:49314548-49314570 CCCCCTAGGCAGTTGCCTCATGG - Intronic
1077996221 11:7454612-7454634 CCCCGTAGGCAGTTTCCTATTGG - Intronic
1080578744 11:33623814-33623836 CCCAGTGGGAAGTTGCCTATAGG - Intronic
1080883772 11:36346739-36346761 CTCCGTAGGCAGTGACCTAAAGG + Intronic
1085375289 11:76055055-76055077 AATCGTAGGCAGCTTCCTATAGG - Intronic
1090627917 11:128621999-128622021 CCCTATAGGCAATTTCCCATAGG + Intergenic
1102490806 12:113288618-113288640 CCCCGCAGGCACTTTCCAGTTGG + Intronic
1103338250 12:120206319-120206341 CCTCGTATGCAGTTTGCAATAGG + Intergenic
1106130599 13:26936267-26936289 CCCAGTAGGCAGTGTCCCAGTGG - Intergenic
1109414055 13:62012171-62012193 CCCCGTGGGCAGGGTCCTTTGGG - Intergenic
1114228216 14:20757751-20757773 CCACTTAGGCAGATGCCTATGGG + Intergenic
1115140786 14:30168746-30168768 TCCAGTAGGCAGTGTCCCATTGG + Intronic
1122205098 14:100144431-100144453 TCCCGTAGGGAGTTCCCTACAGG - Exonic
1128390122 15:67176996-67177018 CCCCGTAGTCATTCTCCTAGAGG + Intronic
1131337341 15:91562080-91562102 CTCTGTAGGCAGTCTCCTAGAGG - Intergenic
1140482307 16:75268078-75268100 CCCCAGAGGCTGTTCCCTATAGG - Intergenic
1154004973 18:10519415-10519437 CGCCTTAGCCAGTTTCCTACTGG + Intergenic
1156447104 18:37245260-37245282 CCCCTGAGGCAGGTTCCTATTGG - Intronic
1160357243 18:78238890-78238912 CCCCGTGGGCACTTTCCTGACGG + Intergenic
1167293504 19:48636759-48636781 CCCCGCACGCAGGTTTCTATGGG + Intronic
926414163 2:12632744-12632766 CCCCTTGGGCAGTTTCCTATGGG + Intergenic
929624284 2:43390332-43390354 CTCTGTTGGCACTTTCCTATGGG + Intronic
937050326 2:118883100-118883122 CCCCGGGGGCAGTTTCCTGTTGG + Intergenic
938382872 2:130846493-130846515 CCCCGCAGGCAGGTTCCTGAGGG - Intronic
943663687 2:190586311-190586333 CCCCGAAGTCAGTTTCGTTTTGG + Intergenic
1171475777 20:25407642-25407664 CGCCGTAGGCGCGTTCCTATTGG + Intergenic
1173194691 20:40904739-40904761 CCCCTTAGGCAGTGTGGTATTGG - Intergenic
1181894182 22:26092613-26092635 CCCCGTGGGCTGTTTCCTGAAGG - Intergenic
1185397465 22:50600417-50600439 CGCCGTGGGCTGTTTCCTCTGGG - Intronic
954761641 3:52878842-52878864 TCCTGAAGGCAGTGTCCTATCGG - Intronic
958256587 3:91332270-91332292 TCCAGTAGGCAGTGTCCCATTGG - Intergenic
986545981 5:8897524-8897546 CTCCGTAGTTAGTTTCCTACTGG + Intergenic
987734432 5:21822304-21822326 CTCTATAGACAGTTTCCTATTGG - Intronic
1001720174 5:173850728-173850750 CCCCTGTGGCAGTTTCCTCTCGG + Intergenic
1003185909 6:3830394-3830416 CCCTGTAGACAGTTGCCTCTTGG - Intergenic
1009187236 6:60588269-60588291 TCCAGTAGGCAGTGTCCCATTGG + Intergenic
1039648000 8:39307996-39308018 CCAGGTAGCCACTTTCCTATTGG - Intergenic
1039650128 8:39332536-39332558 CCCAGGAGGCCTTTTCCTATTGG + Intergenic
1049477495 8:142803565-142803587 TCCCGTAGGGGGTTTCCTGTAGG + Intergenic
1049477639 8:142804213-142804235 TCCTGTAGGAAGTTTCCTGTAGG + Intergenic
1049477675 8:142804391-142804413 CCCTGTAGGGAGTATCCTGTAGG + Intergenic
1054825069 9:69565504-69565526 GCCAGTAGGCAGCTGCCTATTGG - Intronic
1190515841 X:51222953-51222975 CCCCATAGGCAGCCTCTTATGGG - Intergenic
1194004685 X:88476101-88476123 CCTCTTAGCTAGTTTCCTATTGG + Intergenic
1197385526 X:125796479-125796501 TCCAGTAGGCAGTGTCCTAGTGG - Intergenic