ID: 1077997364

View in Genome Browser
Species Human (GRCh38)
Location 11:7465671-7465693
Sequence GAAAATGGACTAATACAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1528
Summary {0: 4, 1: 43, 2: 209, 3: 431, 4: 841}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077997364_1077997367 8 Left 1077997364 11:7465671-7465693 CCCAGCTGTATTAGTCCATTTTC 0: 4
1: 43
2: 209
3: 431
4: 841
Right 1077997367 11:7465702-7465724 GACAAAGACATATCCGAGAGTGG 0: 1
1: 3
2: 115
3: 1441
4: 5775
1077997364_1077997371 30 Left 1077997364 11:7465671-7465693 CCCAGCTGTATTAGTCCATTTTC 0: 4
1: 43
2: 209
3: 431
4: 841
Right 1077997371 11:7465724-7465746 GGAAGAAAAAGAGGTTTAACTGG 0: 48
1: 823
2: 933
3: 722
4: 1767
1077997364_1077997368 9 Left 1077997364 11:7465671-7465693 CCCAGCTGTATTAGTCCATTTTC 0: 4
1: 43
2: 209
3: 431
4: 841
Right 1077997368 11:7465703-7465725 ACAAAGACATATCCGAGAGTGGG 0: 1
1: 4
2: 180
3: 2181
4: 8671
1077997364_1077997370 21 Left 1077997364 11:7465671-7465693 CCCAGCTGTATTAGTCCATTTTC 0: 4
1: 43
2: 209
3: 431
4: 841
Right 1077997370 11:7465715-7465737 CCGAGAGTGGGAAGAAAAAGAGG 0: 3
1: 198
2: 994
3: 930
4: 960

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077997364 Original CRISPR GAAAATGGACTAATACAGCT GGG (reversed) Intronic
900723550 1:4198290-4198312 GAAACTGGACTAATACTGTTAGG - Intergenic
900879857 1:5373077-5373099 GAGAACAGACTAATACAGCATGG + Intergenic
900939805 1:5791449-5791471 GAGAATGGACTAATACAGGCAGG + Intergenic
901252344 1:7790166-7790188 AAGAATGGACTAATACAGAAGGG - Intronic
901291241 1:8125971-8125993 GAAAATGGATTAATACAATGGGG - Intergenic
901767236 1:11510795-11510817 GAAAAGGAACTAATACAGATGGG - Intronic
901848402 1:11999327-11999349 GAAGATGCACTAATGCAGCAGGG - Intronic
902060476 1:13637942-13637964 GAGAATGGACTAATACAATCTGG - Intergenic
902083999 1:13843170-13843192 GACAATGGACTAATACAAGAAGG + Intergenic
902268628 1:15287302-15287324 GAGAATGGACTAATACATCTGGG - Intronic
902740351 1:18433581-18433603 GAAAACGGACTAATACAGGGAGG + Intergenic
902939745 1:19792171-19792193 GAAAATGGACTAATACACCAAGG + Intronic
903146673 1:21377211-21377233 GAAAATGAACTAATAAAGATGGG + Intergenic
904198713 1:28805183-28805205 GAAAACCGACTAATACAGGGAGG - Intergenic
904313503 1:29644861-29644883 GAGAATGGACTAATACAGGAAGG - Intergenic
905027836 1:34863390-34863412 CAAAATGGACTAAAACACCCTGG + Intergenic
905290396 1:36917765-36917787 GAAAACGGACTAATACAGGGAGG + Intronic
906463947 1:46059286-46059308 GAAAATGGACTAATACAAATGGG + Intronic
907625427 1:56024680-56024702 GAGAACAGACTAATACAGCTGGG + Intergenic
907721066 1:56972708-56972730 GAAAATGGACTAATACAGATAGG + Intergenic
907726057 1:57021684-57021706 GAGAATGGACTAATACACCCAGG + Intronic
907874423 1:58471939-58471961 AAGAACAGACTAATACAGCTGGG + Intronic
908048891 1:60205991-60206013 GAAAATGGACTAATACAATGTGG + Intergenic
908076245 1:60522584-60522606 GAAAGTGGACTAATACAACATGG - Intergenic
908211434 1:61904577-61904599 GAGAATGGACTAATACAGAAGGG - Intronic
908427724 1:64024176-64024198 GAAAATGGACTAATACAAATGGG + Intronic
908587730 1:65590715-65590737 AAGAATGGACTAATACAGTCTGG + Intronic
908699470 1:66882146-66882168 GAAAACAGAGTAATACAGTTGGG + Intronic
908875838 1:68674685-68674707 GAAAACAGACTAATACATATAGG - Intergenic
908912192 1:69084930-69084952 GAAAATAAACTAATAGAGCAAGG - Intergenic
908967693 1:69786481-69786503 GAAAATAGACTAATACAGGGAGG - Intronic
909225732 1:73019796-73019818 GTAAATGGAATTGTACAGCTTGG + Intergenic
909510911 1:76451170-76451192 GAGAATGGACTAATACAGATGGG - Intronic
909525118 1:76613887-76613909 GAGAATGGACTAATACAGTAAGG + Intronic
909529563 1:76667218-76667240 GAGAATGGACTAATTCACCTGGG - Intergenic
909588431 1:77318066-77318088 GAGAATGAACTAATACAATTGGG - Intronic
909751522 1:79166685-79166707 GAGAATGGACTAATATAGATGGG + Intergenic
909866870 1:80685242-80685264 GAAAATGAACTAATACAGTGGGG - Intergenic
910028767 1:82690073-82690095 AAAAACAGACTAATACAACTGGG - Intergenic
910105887 1:83630620-83630642 GAAAATTGACTAATACAGATAGG + Intergenic
910123764 1:83818382-83818404 GAGAAAGGACTAATACATTTTGG - Intergenic
910621197 1:89257087-89257109 GAAAATGGACTAATATACTTAGG - Intergenic
910807628 1:91204482-91204504 GAATATGGACTAAGACAGGGTGG - Intergenic
910860625 1:91739695-91739717 GAGAATGGACTAATGCAGCAGGG - Intronic
911067625 1:93805260-93805282 GAATACTGACTAATACAGCAGGG + Intronic
911268997 1:95777717-95777739 GAAAACAGACTAATACAGGTGGG - Intergenic
911370017 1:96985560-96985582 GAAAATGAACTAATATAGTTAGG - Intergenic
911391884 1:97255665-97255687 GAAAACAGACTAATACAGAGGGG + Intronic
911483380 1:98473856-98473878 GAGAATGAACTAATACACTTGGG + Intergenic
911554950 1:99332140-99332162 GAGAATGGACTACTACAAGTGGG + Intergenic
911629558 1:100167010-100167032 GAAAACAGACTAATACACCAGGG + Intronic
911760456 1:101608550-101608572 GAGAATGGACTAATACACTTAGG + Intergenic
911818964 1:102391856-102391878 GAAAATAGATTAGTGCAGCTGGG + Intergenic
912071201 1:105811806-105811828 GAAAATGGACTAATACACCCTGG + Intergenic
912200557 1:107452865-107452887 CAAAATGGACTAAAACAAATGGG + Intronic
912315809 1:108666872-108666894 CAAAATGGACTAATACAGAGAGG + Intergenic
913197615 1:116471086-116471108 CAAAATGGACTAAGACACCATGG + Intergenic
913242231 1:116839029-116839051 GAAAAAGGACTAATACAGAGAGG + Intergenic
913254034 1:116938273-116938295 GAAAACGGACTAATATTCCTTGG - Intronic
913316441 1:117557880-117557902 GAAAATGAACTAATACAGAGGGG - Intergenic
913370187 1:118090094-118090116 GAAAATGGACTAATACAATGGGG + Intronic
913490506 1:119375607-119375629 GAAAATGGACTAATACAATCAGG - Intronic
914007847 1:143748864-143748886 CAGAATGGACTAATACACATGGG - Intergenic
916147607 1:161754443-161754465 GAAAATAGACTAATACACGATGG - Intronic
916341322 1:163739047-163739069 GAAAATGGACTAGTACAGCTGGG - Intergenic
916512347 1:165483453-165483475 GAGAATGGACTAATACACTTGGG - Intergenic
917103903 1:171473021-171473043 GAAAACGGACTAATACATGCAGG - Intergenic
917690714 1:177465612-177465634 GAGAATGGAGTAATACAGAAGGG - Intergenic
918062622 1:181075046-181075068 GAGAATGGACTAATACAATAAGG + Intergenic
918073350 1:181150161-181150183 GAAAATGGACTAAGACAAATGGG - Intergenic
918356567 1:183710499-183710521 GAAAATGGACTAATACACCTGGG - Intronic
918429554 1:184444586-184444608 GAAAATGGACTAATACAACTGGG + Intronic
918466591 1:184827213-184827235 GAAAACGGACTAATACAGTGGGG + Intronic
918759037 1:188377695-188377717 GAGAATAGACTAGTACAGCAAGG + Intergenic
919054311 1:192550624-192550646 TATAAGGGGCTAATACAGCTTGG + Intergenic
919133267 1:193477142-193477164 GAAAATAGACTAATACAGGGTGG + Intergenic
919160657 1:193825894-193825916 GAGAATGGACTAATACACCATGG + Intergenic
919279007 1:195462426-195462448 GAAAATGCACTAATACATTGAGG - Intergenic
919502560 1:198355746-198355768 GAGAACGGACTAATACAGACAGG + Intergenic
919584236 1:199416274-199416296 GAAAATGGACTAATACAGGGAGG + Intergenic
920734401 1:208517718-208517740 GAAAATGAACTAATACAGATTGG - Intergenic
920909936 1:210206831-210206853 GAAAATAGACTAATACACAGAGG + Intergenic
921275925 1:213520134-213520156 GAAAATGGACTAATACACAGAGG - Intergenic
921362556 1:214343322-214343344 GAAAATGGACTAATACCATTAGG + Intergenic
921457159 1:215385962-215385984 GAAAACAGGCTAATACAGATGGG - Intergenic
921457363 1:215388657-215388679 GAGAATGAACTAATACAGCTGGG - Intergenic
921464933 1:215476549-215476571 GAGCATGAACTAATACAGGTAGG - Intergenic
921494064 1:215814792-215814814 GAAAACGAACTAAGACACCTGGG + Intronic
921894062 1:220380548-220380570 GAAAATGGACTAATATACCTGGG + Intergenic
921981880 1:221267766-221267788 AAGAATGGGCTAATACAGCAGGG - Intergenic
922096247 1:222445408-222445430 CAAAATGGACTAACACAGACGGG - Intergenic
922569824 1:226627812-226627834 GAAAATGGACTAATGCAGGTGGG - Intergenic
922666285 1:227472173-227472195 GAGAACAGACTAATACAGTTGGG + Intergenic
922877933 1:228955452-228955474 GAAAATGGACTAAGACAGAAAGG + Intergenic
922892983 1:229075846-229075868 GAATATTGGCTAATACTGCTAGG - Intergenic
923108566 1:230872755-230872777 GAATATGGACTAAGACAACATGG + Intergenic
923269753 1:232345025-232345047 TAGAATGGACTAATACAGTATGG - Intergenic
923311488 1:232739799-232739821 GAAAACAGACTAATATAGCAGGG + Intergenic
923438419 1:233992267-233992289 AGAAATGGACTAAGACAGATGGG - Intronic
923459474 1:234196038-234196060 GGAAATGGACTAATACAAGGTGG + Intronic
923707822 1:236359510-236359532 AAAAATGGACTAATACAGCTGGG - Intronic
923802616 1:237225286-237225308 GAAAACGGACGAATACAGGTGGG - Intronic
923835642 1:237608316-237608338 GTAGATGGACTCATACAACTCGG + Intronic
923977892 1:239285347-239285369 GAAAACAGACTAATGCAGCATGG - Intergenic
924175227 1:241384842-241384864 GAAAATGGACTAATAGAATAAGG - Intergenic
924205043 1:241703679-241703701 GAAAATGGATTAATACACAACGG - Intronic
924419806 1:243897527-243897549 GAGAATAGACTAATACAGTGGGG - Intergenic
924861599 1:247929269-247929291 GAAAATTGACTCATTAAGCTAGG - Intergenic
1063303294 10:4873375-4873397 GAAAATGGACTAATACAGTCAGG + Intergenic
1063752676 10:8968841-8968863 GAAAACATACTAATACACCTAGG - Intergenic
1063909174 10:10812072-10812094 GAAAATGGACTAATATAGGTGGG - Intergenic
1064777010 10:18789774-18789796 GAAAACAGACTAATACAGTAGGG + Intergenic
1064791569 10:18962412-18962434 GAAAATGGACTAATACAGGAGGG - Intergenic
1064930886 10:20625283-20625305 GAAAATGGACTAATACAGAAAGG - Intergenic
1065197156 10:23277776-23277798 GAGAATAGACTAACACAGATGGG - Intronic
1065440921 10:25752659-25752681 GAAAATGGACTAATACAAGGGGG + Intergenic
1065601330 10:27371771-27371793 GAAAACAGACTAATACAGAGGGG + Intergenic
1065698536 10:28402693-28402715 GAGAATGAACTAATACAGTAGGG - Intergenic
1065751232 10:28889869-28889891 GAAAATGGACTAATACACACAGG - Intergenic
1065905556 10:30248078-30248100 GAGAATGGACTAATACAAACAGG + Intergenic
1066113886 10:32222623-32222645 GAGAACAGACTAATACAGCATGG - Intergenic
1066191993 10:33064515-33064537 GAAAATGAACTAATACACAAGGG + Intergenic
1066247681 10:33599300-33599322 AAAAATAGACTAATACAGGTTGG - Intergenic
1066281473 10:33922310-33922332 GAAAATGGACTAATACAGAACGG + Intergenic
1066416417 10:35225530-35225552 GAGAACAGACTAATACAGATAGG + Intergenic
1066756110 10:38714566-38714588 GAAAACGGATTGATACAGTTTGG - Intergenic
1067111714 10:43406091-43406113 GAAAATGGAGTAAAACTTCTAGG + Intronic
1067471716 10:46542676-46542698 GAAAATGGACTAATATGGAGGGG + Intergenic
1067736964 10:48863712-48863734 GAAAACGGACTAATACAAAAAGG - Intronic
1068049187 10:51927460-51927482 GAAAATGGACTAATACAATAGGG + Intronic
1068148255 10:53098589-53098611 GAGAATGAACTAATACAACGAGG + Intergenic
1068229691 10:54156274-54156296 GAAAACAGACTAATACAGATGGG - Intronic
1068264423 10:54627638-54627660 GAAAATGGACTAATACAGCCAGG + Intronic
1068434218 10:56970066-56970088 GAGAATGGACTAATATAGTGGGG - Intergenic
1068510791 10:57963443-57963465 GAAAAGGAACTAATACACCCAGG - Intergenic
1068644639 10:59451783-59451805 GAAATTAGAGTAATGCAGCTAGG + Intergenic
1068924899 10:62526261-62526283 GAAAATGGACTAATACAGAAGGG - Intronic
1069155358 10:65022989-65023011 CACAATGGACAAACACAGCTTGG - Intergenic
1069887425 10:71632825-71632847 CAAAATGGACTAAGACACGTGGG - Intronic
1070210650 10:74316709-74316731 GAAAATGAACTAATACCGGGAGG + Intronic
1070521547 10:77257951-77257973 GAAAACGGACTAATATAACCAGG + Intronic
1070895160 10:79977106-79977128 GAAAACAGACTAATACAGTGGGG + Intronic
1070922296 10:80195642-80195664 GAAAATGGACTAATACAAGGTGG - Intronic
1070939786 10:80334445-80334467 CAAAATGGACTAAGACAAATAGG - Intergenic
1071130185 10:82382016-82382038 GAAAAAGAACTTATACTGCTAGG - Intronic
1071723306 10:88169423-88169445 GAAAATGGACTAATACCACTGGG - Intergenic
1072322009 10:94259737-94259759 GAAAATGGACTAATATAGTCGGG - Intronic
1072491880 10:95914818-95914840 GAGAATGGACTAATAGAGTCAGG + Intronic
1072883810 10:99255822-99255844 GAAAATGGACTAATGCAACTGGG - Intergenic
1073571383 10:104583596-104583618 GAAAATGGACTAATACAGCAGGG + Intergenic
1073591610 10:104762891-104762913 GAAAATAGACAAATACACCTGGG + Intronic
1073667313 10:105548057-105548079 GAGAATGGACTAATACAGAGAGG + Intergenic
1073732843 10:106310987-106311009 CAAAATGGACTAAGACACCTAGG + Intergenic
1073785665 10:106886351-106886373 AAAAATGGACTAATACACCATGG + Intronic
1073833269 10:107411308-107411330 GAAAATGGACTAACACAGACTGG + Intergenic
1074258843 10:111831825-111831847 GAGAATGGACTAATACATCTGGG - Intergenic
1074287354 10:112110634-112110656 GGAAATGGACTAATACACCCAGG + Intergenic
1074404403 10:113168782-113168804 GAAAATGCACATAAACAGCTTGG - Intergenic
1074440275 10:113471818-113471840 CAAAATGGACTAACACAGCAGGG - Intergenic
1074558028 10:114509774-114509796 GAGAACGGACTAATACAGGCAGG - Intronic
1074662528 10:115677731-115677753 GAAAACAGACTAATAGAGCAAGG + Intronic
1074689007 10:115987145-115987167 GAAAATGGAGTAATACAAGTGGG - Intergenic
1074940662 10:118233569-118233591 GAAAACGGACTAATACACAAGGG - Intergenic
1074961133 10:118447255-118447277 GAAACTGGACTAATAAATTTGGG - Intergenic
1075081945 10:119390194-119390216 GAAAACGGACTAATACAGACGGG - Intronic
1075152257 10:119944434-119944456 GAAAATGGACTAATACAGTCAGG + Exonic
1075350471 10:121720192-121720214 GAAAATGGACTAACATAGTAGGG - Intergenic
1075825991 10:125357392-125357414 GAAAATGGACTAATACAGCTGGG - Intergenic
1076211050 10:128645237-128645259 CCAAATGGACTAAGACACCTGGG - Intergenic
1076275406 10:129194524-129194546 GAAAATGGACTAATACATAGAGG - Intergenic
1076689917 10:132217910-132217932 GAAAATAGACTAATACAGATGGG + Intronic
1077180809 11:1214283-1214305 GAAAATGGACTAATACAGAACGG - Intergenic
1077667877 11:4131015-4131037 GAGAATCGACTAATACAACTGGG - Intronic
1077761114 11:5099463-5099485 GAAAATGGGCTAATACAATAGGG + Intergenic
1077931129 11:6734214-6734236 ACAAATGGACTAAGACAGCAGGG + Intergenic
1077997364 11:7465671-7465693 GAAAATGGACTAATACAGCTGGG - Intronic
1078159041 11:8824560-8824582 GAAAATGTACATATACAGCATGG - Intronic
1078408185 11:11089470-11089492 GAAAAGGGACTAATACGCCGTGG + Intergenic
1078477408 11:11642959-11642981 GAAAATGGACTTAGACAGCAAGG - Intergenic
1078516212 11:12024481-12024503 GAGAATGGACTAATACAATGGGG + Intergenic
1078518672 11:12046590-12046612 GAAAATGGAGTAATACAGTGGGG + Intergenic
1078959362 11:16247404-16247426 GAGAATGGACTAATACAGAAAGG - Intronic
1079538200 11:21540453-21540475 GAGAACAGACTAATACAGCCAGG - Intronic
1079554243 11:21739792-21739814 GAAAATAGACTAATACAGTGGGG - Intergenic
1079570950 11:21942641-21942663 GAGAATGGACTAATACATCCAGG + Intergenic
1079927759 11:26516593-26516615 GAAAATGCACTAATGCACATAGG + Intronic
1079992322 11:27259356-27259378 GAGAATGGACTAATACAACCAGG - Intergenic
1080194702 11:29595485-29595507 GAGAATGGACTAATACACCAAGG + Intergenic
1080227735 11:29978543-29978565 GAAAATGGACTAATACAGTTGGG + Intergenic
1080290385 11:30664513-30664535 GAGAATGGACTAATACATTTGGG - Intergenic
1080367977 11:31599535-31599557 GAGAATGAACTAATACAGCCAGG - Intronic
1080715831 11:34798734-34798756 GAGAATGGACTAATACAGCTAGG + Intergenic
1080824809 11:35838938-35838960 GAAAATGGACTAATACAGATGGG - Intergenic
1080958683 11:37131445-37131467 GAAAATGGACTACTACAGGATGG + Intergenic
1081445030 11:43122853-43122875 GAGAATGGACTAATACAAACTGG + Intergenic
1082043626 11:47707288-47707310 GAAAATGGACTAACACAGCTGGG - Intronic
1082197035 11:49319138-49319160 GATTTTGGACTACTACAGCTTGG + Intergenic
1082203232 11:49399057-49399079 GAAAATTGACTGATACAGTAGGG + Intergenic
1082865760 11:57898803-57898825 GAAAATGAACTAACACACCGTGG + Intergenic
1083024616 11:59539995-59540017 GAGAACGGACTAATACATATAGG - Intergenic
1083236163 11:61352024-61352046 GTAAAAGGATTATTACAGCTGGG - Intronic
1083917036 11:65753665-65753687 GAACACTGACTAATACAGATGGG + Intergenic
1084720895 11:70904994-70905016 GAAAATGGACTAATACAGTGGGG + Intronic
1085617868 11:78015348-78015370 GAAAACAGACTAATACAGATGGG + Intergenic
1085727707 11:78968551-78968573 CAAAATGGGCTAACACAGTTAGG + Intronic
1085799878 11:79579629-79579651 GAAAATGGACTAATACACATGGG - Intergenic
1086059445 11:82685213-82685235 GAGAATGAACTAATATACCTTGG + Intergenic
1086146779 11:83560848-83560870 GAGAATGGACTAATACACAGGGG - Intronic
1086284528 11:85231065-85231087 AAAAGTGGACTAATACATGTAGG + Intronic
1086534557 11:87829318-87829340 GAAAATGAACTGATACAACAGGG - Intergenic
1086651805 11:89301022-89301044 GAAAATTGACTGATACAGTAGGG - Intergenic
1086862751 11:91944313-91944335 AAGAATGGACTAATACACTTAGG - Intergenic
1087497750 11:98911266-98911288 GAAAACAGACTAATACAAATAGG + Intergenic
1087812864 11:102626846-102626868 GAGAATGGACTAATACACACAGG + Intergenic
1087898160 11:103610548-103610570 GAGAATGGACTAATACAGTAGGG + Intergenic
1087917053 11:103823220-103823242 GAGAATGGAGTAATACAGCAGGG - Intergenic
1088091501 11:106045673-106045695 GGAAAGGGACTAATTCAGGTGGG + Intergenic
1088706186 11:112466576-112466598 GAAAATGGACTAATACAATCAGG - Intergenic
1088733344 11:112703550-112703572 GAATATGGACTAATACACCTGGG + Intergenic
1088762674 11:112947462-112947484 GAGAATGAACTAATAAAACTAGG - Intergenic
1088934664 11:114387607-114387629 GAAAATGGACTAAGACACCTTGG + Intergenic
1089732607 11:120528535-120528557 GAAAACAGACTAATACAGATGGG - Intronic
1089985086 11:122805026-122805048 GAAAACGAACTAACACAGCATGG - Intronic
1090497139 11:127224288-127224310 GAAAATCGAGTAATTCAGTTTGG + Intergenic
1090538704 11:127676411-127676433 GGAAATGCACTAATACAGTATGG - Intergenic
1090924810 11:131240085-131240107 GAAAATGGACTAATAGAAATGGG + Intergenic
1090925613 11:131247497-131247519 GAAAAGGGAATAATACACGTAGG - Intergenic
1091982567 12:4878408-4878430 GAAAATGGACTAATACCAGCAGG - Intergenic
1092514864 12:9199930-9199952 AAAAATGGTCTCATAAAGCTGGG - Intronic
1092795268 12:12104502-12104524 CAAAATGGACTAATACAGCAGGG + Intronic
1093130841 12:15390256-15390278 GAAAACAGACTAATACACCATGG - Intronic
1093185587 12:16015601-16015623 GAAAACGGACTAATACAATTTGG + Intronic
1093202981 12:16211925-16211947 TAAAAATGACTAATGCAGCTTGG + Intronic
1093277458 12:17147966-17147988 GTAAATGGATTAATTCATCTGGG + Intergenic
1093315759 12:17647671-17647693 GAAAATGGACTAATACACTGGGG + Intergenic
1093324601 12:17758987-17759009 GAAAACGAACTAATACAGGAAGG - Intergenic
1093505696 12:19863119-19863141 GTAAATAGACTGACACAGCTGGG - Intergenic
1093570872 12:20664243-20664265 GAGAATGGACTAATACACCAGGG + Intronic
1094025240 12:25955070-25955092 GCAAATGGACCAGTACAGATGGG - Intergenic
1094236889 12:28178159-28178181 GAAAATGGACTAATACACTTGGG + Intronic
1094271853 12:28625908-28625930 GAAAATGAACTAATACACTCCGG + Intergenic
1094367959 12:29704083-29704105 GAAAATGTACAAATACACTTAGG + Intronic
1094372915 12:29757639-29757661 GAAAACAGACTAATACAACCTGG - Intronic
1095174554 12:39076318-39076340 TAAAATATACAAATACAGCTGGG - Intergenic
1095201837 12:39393752-39393774 GAAAGGGAACTAATACAGGTTGG + Intronic
1095249983 12:39968050-39968072 GAGAATAGACTAATACAGGAGGG - Intronic
1095270548 12:40213878-40213900 AAAAATGGACTAAGACAGTCAGG - Intronic
1095527208 12:43141230-43141252 AAGAATGGACTAATACAAGTAGG + Intergenic
1095557188 12:43522035-43522057 GAGAACGAACTAATACAGCTGGG - Intronic
1095611784 12:44137502-44137524 GAAAATGGACTAAGACAACATGG - Intronic
1096283211 12:50274877-50274899 GAGGAAGGAATAATACAGCTAGG + Intronic
1096368236 12:51046685-51046707 GAAAGTTGACTAAGACGGCTGGG - Intergenic
1096422134 12:51468037-51468059 GAAAAGGGACTATTACAGAATGG - Intronic
1096457041 12:51796080-51796102 GAAACTGGTCTAATAAAGGTGGG - Intronic
1097139439 12:56887548-56887570 GAGAATGGACTAATACAGACTGG + Intergenic
1097256036 12:57675199-57675221 GAAAATTGACAAATACAGGGAGG + Intergenic
1097368269 12:58743462-58743484 GAGAATGGATTAATACAGTATGG + Intronic
1097617099 12:61897368-61897390 GAAAATGGACTACTATATCATGG - Intronic
1097662631 12:62447385-62447407 GAACATGGACTAATACATGGAGG - Intergenic
1097894128 12:64807373-64807395 GAGAATGGACTAATACAGAGAGG + Intronic
1097933023 12:65211964-65211986 GAGAACAGACTAATACAACTTGG - Intronic
1097955656 12:65483140-65483162 GAAAATGGACTAATACAGCCTGG + Intronic
1098144799 12:67487506-67487528 GAGAATGGACTAATACAGCTGGG - Intergenic
1098256182 12:68618056-68618078 GAACAAGAACTAATACAGCTGGG - Intronic
1098278421 12:68837245-68837267 CAAAATGTACAAATTCAGCTGGG - Intronic
1098306409 12:69107119-69107141 AAAAGTGGACTAATACACTTTGG - Intergenic
1098536346 12:71597632-71597654 TAAAATGAACCAATACACCTGGG + Intergenic
1099039404 12:77632279-77632301 GAAAACGGGCTAATACAGATTGG - Intergenic
1099443353 12:82724663-82724685 GAAAACGGACTAATACAACTTGG + Intronic
1099500690 12:83410646-83410668 GAAAACAGACTAATACAGTGGGG - Intergenic
1099654909 12:85478152-85478174 GAAAACGAACTAATACAACTTGG - Intergenic
1099734455 12:86550283-86550305 GAGAATGGACTAATACACAGAGG + Intronic
1099794876 12:87387356-87387378 AAAAATTGACAAATAGAGCTAGG + Intergenic
1099859521 12:88209430-88209452 GAAAACAGACTAATACAGTAAGG - Intergenic
1100250086 12:92812033-92812055 AAAAATGGACCAATAAAGCCAGG + Intronic
1100285134 12:93158069-93158091 GAAAATGAACTAATATAGTAGGG - Intergenic
1100352810 12:93800743-93800765 GAGAATGGACTAATACAGTGAGG + Intronic
1100898951 12:99216305-99216327 GAAAATGGAGTCATACACCCTGG + Intronic
1101071727 12:101082397-101082419 GAAAATGGACAGATACATCCAGG + Intronic
1101231172 12:102742995-102743017 GAAAATGGACTAATACAAGCTGG + Intergenic
1101260824 12:103027866-103027888 GAGAACGGACTAATACAGCAAGG - Intergenic
1101305350 12:103522389-103522411 GTGAATGGACTAATACAGCTGGG + Intergenic
1101404064 12:104412761-104412783 GAGAACAGGCTAATACAGCTGGG + Intergenic
1101500436 12:105299105-105299127 GAAAATAGACTAATACCACATGG + Intronic
1101699410 12:107157904-107157926 GAACATGGATTAATACAGGCTGG + Intergenic
1102392635 12:112561901-112561923 GAGAACGGACTAATACACATTGG + Intergenic
1102401521 12:112633708-112633730 GAAAATGGAATAAGACAGTCAGG + Intronic
1102528830 12:113531420-113531442 GAAAATGGACTAATACACATGGG + Intergenic
1102560780 12:113760845-113760867 GAAAATGGACTTGTACCACTGGG - Intergenic
1102622161 12:114204737-114204759 CAAAATGGACTAAGACAGTCTGG + Intergenic
1102716536 12:114978291-114978313 GAAAATGGACTAATACACTGAGG - Intergenic
1102937615 12:116911034-116911056 GAATATGGACGACTACAGCCTGG + Exonic
1103005774 12:117418959-117418981 GAGAATGGCTTAATACACCTTGG + Intronic
1103015856 12:117494030-117494052 GAAAATGGACTAATACGGGCAGG + Intronic
1104100082 12:125599392-125599414 GAGAATGGATTAATACAGGGAGG + Intronic
1104159546 12:126165119-126165141 GAAAATGGACTAATACCGTGGGG + Intergenic
1104260045 12:127173908-127173930 GAGAATGGACTAATTCAGTGAGG - Intergenic
1104268276 12:127258882-127258904 GGGAATGGACTAATACAACTGGG - Intergenic
1104304832 12:127600219-127600241 GAAAATGGACTAATACAAAAAGG + Intergenic
1104487565 12:129164485-129164507 GAAAATGGACCAATACAGCTGGG - Intronic
1104489509 12:129181829-129181851 GAAAATGGACAAATAAAGGATGG - Intronic
1104498312 12:129261565-129261587 GAAAATGGACTAATACAGACTGG + Intronic
1104505775 12:129330817-129330839 GAAAATAGACAAATACACCAAGG + Intronic
1104572098 12:129934459-129934481 GAAAATGGACTAATACAAATGGG + Intergenic
1104799134 12:131541509-131541531 GAAAATGGACTAATACAAGGAGG - Intergenic
1105706780 13:22972084-22972106 AAGAATGGCTTAATACAGCTGGG - Intergenic
1105818708 13:24060765-24060787 AAAAATGGACAAATGCGGCTGGG + Intronic
1105977272 13:25482952-25482974 GAAAACGGACTAATACAGAAGGG + Intronic
1106309827 13:28544428-28544450 TAAAACGGACTAATACAGAAGGG - Intergenic
1106382408 13:29252961-29252983 GAAAATGGACTAATAGAAGTAGG + Intronic
1106499469 13:30313571-30313593 GAAAAAGGAGCAGTACAGCTGGG + Intergenic
1106910353 13:34456543-34456565 GAAAATGAACTAATACAATTAGG + Intergenic
1106915955 13:34514761-34514783 GAAAACAGACTAATACAGTTGGG - Intergenic
1107120335 13:36789005-36789027 GAAAATGGACTAAGACACCCAGG - Intergenic
1107183041 13:37484615-37484637 GAAAACGGACTCATACAGATGGG - Intergenic
1107586312 13:41851743-41851765 GAAAATGGATTAATACAGACGGG + Intronic
1107656083 13:42593026-42593048 GAAAACAGACTAATACAGGCTGG + Intronic
1108174448 13:47777824-47777846 CAGAATGGACTAACACAGTTTGG + Intergenic
1108263879 13:48685020-48685042 GAGAATGGACTAATACAGCAGGG - Intronic
1108441386 13:50456625-50456647 GAGAATGGACCAACACAGCTTGG - Intronic
1108686885 13:52827346-52827368 GAAAGTGGACTAATACGGGCTGG + Intergenic
1108754668 13:53485408-53485430 GAGAATGGAATAATACAGATAGG + Intergenic
1108842652 13:54639105-54639127 GAGAGTGGACTAATACAGGGTGG + Intergenic
1109107787 13:58277155-58277177 GAAAATGGACTAATACAATGAGG - Intergenic
1109109201 13:58293868-58293890 GAGAATCGACTAATACAGATGGG + Intergenic
1109286952 13:60421132-60421154 GAAAATGAACTAATACAATATGG - Intronic
1109337322 13:61009115-61009137 GAAAATGGACTAATACATATGGG + Intergenic
1109588702 13:64446444-64446466 GAAAATGGACTAATACAACAGGG - Intergenic
1109642093 13:65203764-65203786 GAAAACAGATTAATACAACTAGG + Intergenic
1109687012 13:65833184-65833206 GAAAATAGACTAATATAATTTGG + Intergenic
1109879475 13:68451857-68451879 GAAAACAGACTAATACACATGGG + Intergenic
1109880253 13:68463954-68463976 GAGAATGAACTAATACACCTAGG + Intergenic
1109893536 13:68651760-68651782 TACAAGGGACTAATGCAGCTGGG + Intergenic
1110062535 13:71061403-71061425 GAGAACAGACTAATACACCTTGG - Intergenic
1110178296 13:72584541-72584563 GAAAACAGACTAATACAGTGGGG - Intergenic
1110187437 13:72691901-72691923 GAGAATGGACTAATAGAGTTAGG - Intergenic
1110357108 13:74579094-74579116 GCAAATGGACTAATACAAGGTGG + Intergenic
1110361556 13:74631059-74631081 AAAAATGGACTAATACACCCTGG + Intergenic
1110378007 13:74815505-74815527 GAAAATGGACTAATACACCTAGG + Intergenic
1110439794 13:75515398-75515420 GAAAATGGACTAACACAGGAGGG - Intergenic
1110440010 13:75517275-75517297 CAAAATGGACTAAGACACCCAGG + Intergenic
1110449391 13:75624523-75624545 GAAAACAGACTAATACAGGTGGG - Intronic
1110462323 13:75758915-75758937 GAAAATGAACTAATACACACAGG - Intronic
1110683230 13:78341325-78341347 GAAAACAGACTAATACACCAAGG - Intergenic
1110741984 13:79008337-79008359 GAGAACGGACTAATACAGAAGGG - Intergenic
1110802481 13:79715400-79715422 GAAAATGGACTAATACACTTTGG - Intergenic
1111107138 13:83661216-83661238 GAAAACAGACTAATACACTTTGG + Intergenic
1111189717 13:84791348-84791370 GGAAATGGACTATTACAGAGGGG + Intergenic
1111314085 13:86529066-86529088 GAAAATGGACTAATACACTGTGG + Intergenic
1111344197 13:86926935-86926957 AAAAATGGACTAATACAGCAGGG - Intergenic
1111357388 13:87126357-87126379 AAGAATGGACTAATACACCGAGG + Intergenic
1111388183 13:87557003-87557025 GAACACAGACTAATACAGGTAGG + Intergenic
1111655763 13:91150229-91150251 GAAAATTGACTAATACATCAAGG + Intergenic
1111745652 13:92265767-92265789 CAAAATGGACTAAGACAAATTGG - Intronic
1111801550 13:92987090-92987112 GAAAATGGACTAATAGACATAGG + Intergenic
1111811821 13:93100691-93100713 GAAAATGGACCAAGACAGATGGG + Intergenic
1111812613 13:93110278-93110300 AAGAATGGCCTAATACAGGTTGG + Intergenic
1112033839 13:95479934-95479956 GAAGATGGACTAATACAAAGAGG - Intronic
1112120514 13:96405150-96405172 GAAAACGAACTAATACAGCAGGG + Intronic
1112750875 13:102582270-102582292 GAAAATGAACTAATACACATAGG - Intergenic
1113087936 13:106586878-106586900 GAGAATGGAATAATACAAATGGG + Intergenic
1113103525 13:106747590-106747612 GATTATTGAGTAATACAGCTTGG + Intergenic
1113152594 13:107281641-107281663 GAAAATGGACTAATACAGTCAGG - Intronic
1113693504 13:112328535-112328557 GAAAACAGACTAATACACCTTGG - Intergenic
1113702820 13:112399716-112399738 GAGAATGGACTCATATACCTGGG - Intronic
1113915436 13:113868260-113868282 GAAAATTGACTAATACACTTGGG + Intergenic
1113981012 13:114275876-114275898 GAAAACGGACTAAAAGAACTAGG - Intergenic
1114338131 14:21714289-21714311 GAGAATGGAGTAATACACCTGGG - Intergenic
1114795539 14:25711441-25711463 GAGAATAGACTAATACACATAGG - Intergenic
1114955045 14:27806529-27806551 GAAAACAGACTAATACAGCTAGG + Intergenic
1115006987 14:28498186-28498208 GAAAGTGGACTAATAGAAATAGG - Intergenic
1115085639 14:29512218-29512240 GAGAATGGACTAATACAATCAGG - Intergenic
1115190526 14:30743181-30743203 GAGAATGGACTAATACACACAGG + Intergenic
1115430944 14:33317810-33317832 GAGAATGGACTAATACACCAAGG + Intronic
1115806990 14:37062877-37062899 GAGAATGCACTAATACACCAGGG - Intronic
1116098751 14:40407316-40407338 GAAAACAGACTAATACATGTGGG - Intergenic
1116184395 14:41578104-41578126 GAAAATGGATTAATATATCTGGG + Intergenic
1116371870 14:44145187-44145209 GAAAATGGTCTAATACAAGATGG + Intergenic
1116802659 14:49459289-49459311 GAAAACAGACTAATACAGACTGG + Intergenic
1116854875 14:49943360-49943382 GAAAATAGACTAATACAGCTGGG + Intergenic
1117483931 14:56174816-56174838 GAGAATGGACTAATACAACCAGG + Intronic
1117632891 14:57711385-57711407 GAGAATGGACTGATACACATGGG + Intronic
1117652780 14:57924213-57924235 GAGAATGAACCAATACAGCTGGG + Intronic
1117749388 14:58904182-58904204 GAAAACAGACTAATACAGGGAGG + Intergenic
1117958783 14:61143329-61143351 GAAAATGGACTAATACAGATGGG - Intergenic
1119132923 14:72191394-72191416 GAGAAAGGACTAATACAACATGG - Intronic
1119157228 14:72422261-72422283 GAAAATGGACTAATACAAATGGG + Intronic
1119561032 14:75589951-75589973 CAAAATCGACTAAGACAGCAAGG - Intronic
1119851542 14:77870009-77870031 GAGAATGGACCAACACAGATGGG + Intronic
1120000890 14:79302246-79302268 ACAAATGGACTAACACACCTGGG - Intronic
1120178621 14:81321051-81321073 GAAAACGCACTAATACTGCAGGG + Intronic
1120208710 14:81613262-81613284 GAAAACGGACTAATACAAGGGGG - Intergenic
1120258013 14:82143431-82143453 GAAAATGGACTAATACATATAGG + Intergenic
1120394075 14:83945176-83945198 GAAAACGGACTAATTCAGGTAGG - Intergenic
1120575483 14:86175661-86175683 GAAAATGGACTAATACAGGGAGG + Intergenic
1120692182 14:87605175-87605197 GAAGATGGACTAATACACATGGG - Intergenic
1120708420 14:87768952-87768974 GAGAATGGAATAATATACCTGGG - Intergenic
1120863785 14:89278065-89278087 GAAAATGGACTAATACAGTGGGG - Intronic
1121147230 14:91594643-91594665 AAAAATGGACTAATACAATGGGG + Intronic
1121207348 14:92180456-92180478 GAAAATGGACTAATACAGGTGGG + Intergenic
1121237392 14:92402533-92402555 GAAAATTGACTAATATAGAATGG - Intronic
1121267706 14:92615165-92615187 GAAAATGGACTAATACAAACAGG + Intronic
1121368297 14:93334287-93334309 GAAAATGAAGTAATACAAATTGG - Intronic
1121446647 14:93983027-93983049 GAGAATAGACTAGTACACCTGGG - Intergenic
1121483664 14:94297309-94297331 GAAAATGGACTAATACACTGTGG - Intergenic
1121701716 14:95959679-95959701 AAAAATGGCCTAATACACCAGGG + Intergenic
1121839410 14:97120312-97120334 GAAAACAGACTAATACACCAGGG + Intergenic
1121840872 14:97132714-97132736 GAAAAGAGACTAATACACCAAGG - Intergenic
1121972328 14:98369731-98369753 GAAAATGAACTAATACCACAGGG - Intergenic
1122008034 14:98721952-98721974 GAGAATGGACTAATACAGATGGG + Intergenic
1122054697 14:99086354-99086376 GAGAACAGACTAATACAGTTGGG + Intergenic
1122361979 14:101172863-101172885 GAAAATGGACTAATACAGATTGG - Intergenic
1122850132 14:104523529-104523551 AAGAATGGCCTAATACAGCTGGG - Intronic
1123124447 14:105936254-105936276 GAAAATGGACTAATACACTATGG - Intergenic
1123440367 15:20286625-20286647 GAAAACGGATTGATACAGTTTGG - Intergenic
1123808877 15:23903509-23903531 CAAAATGGACTAATACATTAGGG - Intergenic
1124194316 15:27607448-27607470 AATAATGGCCCAATACAGCTAGG + Intergenic
1124205871 15:27719675-27719697 CAAAATGGACTAAGACAGTGTGG - Intergenic
1124436988 15:29658423-29658445 GATAATTGACGAATACAACTGGG + Intergenic
1124686377 15:31786258-31786280 GAAAACAAACTAATACAGCTGGG + Intronic
1125128375 15:36252069-36252091 GAGAATGGACTAATGCAGAGGGG - Intergenic
1125280087 15:38033916-38033938 GAAAATGGACTAAGACATGGAGG - Intergenic
1125590445 15:40851444-40851466 GAAAATGGCAGAACACAGCTGGG - Intronic
1126272922 15:46843820-46843842 GAAAATGGACTAATATATATTGG - Intergenic
1126383660 15:48072806-48072828 GAAAATGGACTAATACAGGCTGG - Intergenic
1126909073 15:53399364-53399386 GAGAATGGACTAATATACCAGGG - Intergenic
1126982437 15:54259283-54259305 GAAAATGTACTAATACACTTGGG - Intronic
1127007390 15:54585523-54585545 CAAAATGGACTAATACAGATGGG + Intronic
1127008529 15:54596978-54597000 CAAAATGGACTAACACAACTGGG + Intronic
1127100630 15:55561306-55561328 GAGAAGGGACTAATACAGAAGGG - Intronic
1127129095 15:55843239-55843261 GAAAACGGACTAAAACAGCCAGG + Intronic
1127213879 15:56803714-56803736 GAAAATGGTCTGAAACGGCTTGG - Intronic
1127224496 15:56916171-56916193 GAAAATGAACTAAAACACATGGG + Intronic
1127245420 15:57167775-57167797 GAAAATAGAGTAAGACTGCTTGG - Intronic
1127633571 15:60848539-60848561 GAGAAAGGACTAACACAGGTTGG - Intronic
1127969597 15:63947942-63947964 GAGAATGGACTAATACAAGTGGG - Intronic
1128470895 15:67951602-67951624 GAAAATGGACTAATAGAAATGGG + Intergenic
1128596216 15:68952478-68952500 AAGAATGGACTAATACAACGTGG + Intronic
1128718470 15:69927823-69927845 GAAAATGGACTAATCCACAAGGG - Intergenic
1128820210 15:70645408-70645430 GAGAATGGACTAATACACGGGGG - Intergenic
1129585645 15:76861756-76861778 GAAAATGGACTAATACATTTAGG - Intronic
1129990164 15:79955108-79955130 GAAAATTGACTAATGCAGCATGG - Intergenic
1130421866 15:83756221-83756243 GAAAACAGACTAATACAGTGAGG - Intronic
1130448916 15:84031099-84031121 GAAAATGGACTAATACAGAGGGG + Intronic
1131556672 15:93405383-93405405 GAAAATGGACTAATACACCTGGG + Intergenic
1131646929 15:94354642-94354664 GATAACGGAGTAATACAGATAGG + Intronic
1131677877 15:94689667-94689689 GAAAAGAGACTAATACAGAGTGG + Intergenic
1131800250 15:96060923-96060945 GAAAACAGACTAATACAGTAAGG + Intergenic
1131852553 15:96558116-96558138 GAAAATGGACTAATACAAAAAGG + Intergenic
1131874379 15:96789257-96789279 GAGAATGGACTGATACATTTGGG - Intergenic
1131914725 15:97252206-97252228 GAAAATGGACTAATAACGGGTGG + Intergenic
1132279490 15:100601182-100601204 GGAAACGGACTAAGACAGATAGG - Intronic
1132349625 15:101131541-101131563 GAAAATGGACTAATACGATATGG + Intergenic
1132811387 16:1799752-1799774 GAGAATGGACTAATGCAGATGGG + Intronic
1132890544 16:2202196-2202218 GAAAATGGACTAATACTCCATGG - Intergenic
1133693246 16:8236371-8236393 GAAAATGGACTAGTATAGTTTGG - Intergenic
1133791139 16:9010056-9010078 AAAAATACACGAATACAGCTTGG - Intergenic
1133947481 16:10361277-10361299 GAGAATGGACTAATACAAGGGGG + Intronic
1134243459 16:12522816-12522838 GAGAATGGACTAATATAGTCAGG + Intronic
1134600676 16:15531263-15531285 GAGAATGGACTAATACAGTTGGG + Intronic
1134601276 16:15535719-15535741 GAAAATGGACTAATACAAAATGG - Intronic
1134606180 16:15573076-15573098 GAAAATGGACTAATACAACTAGG + Intronic
1134768459 16:16783043-16783065 GAAAATGGACTAATACACCTGGG + Intergenic
1134782610 16:16912021-16912043 GAAAATGGACTAACACACAAGGG + Intergenic
1134804161 16:17110617-17110639 GAGAACAGACAAATACAGCTAGG + Intronic
1134840110 16:17394957-17394979 GAAAATGGACTAATACAGGGGGG - Intronic
1135049075 16:19178016-19178038 GAAAACAAACTAATACAGGTTGG - Intronic
1135073438 16:19372562-19372584 GAAAACAGACTAATACACCAAGG - Intergenic
1135645456 16:24157618-24157640 GAGAATGGACTAATACACATGGG + Intronic
1135645497 16:24157937-24157959 GAGAATGGACTAATACACATGGG + Intronic
1135723367 16:24835601-24835623 GCAAATGGACTAATACAGATGGG - Intergenic
1135808246 16:25564076-25564098 GAAAATGGAATAATACAGCGTGG + Intergenic
1135817427 16:25648062-25648084 GAAAATGGACTAATACAAACAGG + Intergenic
1135828735 16:25754482-25754504 GAGAATGGGCTAGTACAGATGGG - Intronic
1136046707 16:27620958-27620980 GTAAATGGACTTAAGCAGCTAGG + Intronic
1136726571 16:32362302-32362324 GAAAACGGATTGATACAGTTTGG + Intergenic
1136844804 16:33567811-33567833 GAAAACGGATTGATACAGTTTGG + Intergenic
1137230894 16:46566179-46566201 AAAAATGGAAAAATACAGTTGGG + Intergenic
1137309036 16:47235096-47235118 GAGAACGGACTAATACAGAGGGG + Intronic
1137697953 16:50475037-50475059 GAGAACAGACTAATACAGATGGG + Intergenic
1137810812 16:51350852-51350874 GAGAACGGACCAATACAGGTTGG - Intergenic
1137868773 16:51929483-51929505 GAGAAAGGACTAATACAACAGGG - Intergenic
1138088564 16:54155621-54155643 AAGAATGGACTAATACACCAGGG - Intergenic
1138160948 16:54753830-54753852 GAAAACGGACTAATATAATTTGG - Intergenic
1138208602 16:55143957-55143979 CAAAATGGAGTAAGACAGCCAGG + Intergenic
1138406631 16:56800391-56800413 GTAAATGGATTAATAAAGCTTGG - Intronic
1138778160 16:59750543-59750565 GAAAATGGACAAATACACTCTGG - Intronic
1138861334 16:60762028-60762050 GAGAACAGACTAATACAGCCAGG - Intergenic
1138908999 16:61373916-61373938 GAAAATGGACTAATACACCAAGG + Intergenic
1138997786 16:62475405-62475427 AAGAATGGACTAATACAGGGTGG + Intergenic
1139032379 16:62900592-62900614 GAGAATGGACTAATACACCATGG + Intergenic
1139134024 16:64179426-64179448 GAAAATGGACTAATACACCCTGG + Intergenic
1139299540 16:65933678-65933700 GAAAATGGACTAATACAGAAGGG + Intergenic
1139833508 16:69819942-69819964 AGAAATGGAATCATACAGCTGGG + Intronic
1140277372 16:73522708-73522730 GAGAACAGACTAATACACCTTGG - Intergenic
1140356947 16:74314594-74314616 GAAAACGGACTAATACATAAGGG - Intergenic
1140552711 16:75884818-75884840 GAGAATGGACTAATACACAGTGG - Intergenic
1140665326 16:77222219-77222241 GAACCTGGACTAATACAGCAAGG - Intergenic
1140772234 16:78215629-78215651 AAAAACGGACTAATACAGGTTGG + Intronic
1140824370 16:78692138-78692160 GAAAACGGACTAATACAGTGAGG + Intronic
1140998117 16:80280792-80280814 GAGAACTGACTAATACAGCTGGG - Intergenic
1141045076 16:80708524-80708546 GAGAATGAACGAATACATCTTGG + Intronic
1141411277 16:83834801-83834823 GAAAATGGACTAATACATAAGGG + Intergenic
1141573002 16:84945805-84945827 GACAACGGACTAATACAGTTAGG + Intergenic
1141923027 16:87148726-87148748 GAGAATGGACTCATACAGTTGGG - Intronic
1202999863 16_KI270728v1_random:155456-155478 GAAAACGGATTGATACAGTTTGG - Intergenic
1203131461 16_KI270728v1_random:1691856-1691878 GAAAACGGATTGATACAGTTTGG - Intergenic
1203154972 16_KI270728v1_random:1868109-1868131 GAAAACGGATTGATACAGTTTGG + Intergenic
1142471814 17:168937-168959 GAAAATGGACTAATACAGGGAGG + Intronic
1142503328 17:346295-346317 GAAAACGGACTAACACAACTGGG - Intronic
1143308655 17:5970136-5970158 GAGAATGGACTAATAGACATAGG + Intronic
1143316052 17:6034319-6034341 GAAAACAGACTAATACAGGATGG - Intronic
1144515560 17:15915540-15915562 GAACCTTGACTAACACAGCTTGG - Intergenic
1144538358 17:16113981-16114003 GAAAATGAACTAATACATAATGG - Intronic
1144608901 17:16690950-16690972 GAAAATGGATAAACACAGTTGGG - Intronic
1144810523 17:17995934-17995956 GAAAACAGACTAATACAGATAGG - Intronic
1144903919 17:18624870-18624892 GAAAATGGATAAACACAGTTGGG + Intergenic
1145128665 17:20321872-20321894 GAAAATGGATAAACACAGTTGGG - Intergenic
1145195960 17:20895443-20895465 GAAAATGGATAAACACAGTTGGG + Intronic
1145823476 17:27858584-27858606 GAGAACAGACTAATACAGTTGGG + Intronic
1146464479 17:33075381-33075403 AGAAATGGACTAATACAGGTGGG + Intronic
1147928606 17:43961818-43961840 GAAAATGGAATAAAACAGGCCGG - Intronic
1148529203 17:48373058-48373080 GAAAATGGACTAATACAACCTGG - Intronic
1148689372 17:49518132-49518154 AAAAATGAACTAATACAACATGG + Intergenic
1148718041 17:49729797-49729819 AAAAATGGACTAATATGGCCAGG - Intronic
1148966575 17:51440914-51440936 GAAAACAGACTAAGACACCTGGG - Intergenic
1149143303 17:53459252-53459274 GAAAATGAACTAATACAGATGGG + Intergenic
1149145654 17:53490007-53490029 GACAATGAACTAACACAGATAGG - Intergenic
1149251653 17:54777239-54777261 GAAAATGAACTAATGCAGTAAGG + Intergenic
1149260879 17:54878175-54878197 AAAAATGGACTAATACAGTTTGG + Intergenic
1149308828 17:55374487-55374509 GAAAATGGACTAATACAGCTGGG + Intergenic
1150461735 17:65359342-65359364 GACAATGGACGAATAAAACTGGG - Intergenic
1150476836 17:65482088-65482110 GAGAACAGACTAATACAGTTTGG + Intergenic
1150537847 17:66062201-66062223 GAAAATGGACTAATACATAGTGG + Intronic
1150856199 17:68755416-68755438 GAAAACGGACTAATACAGAGAGG - Intergenic
1150971363 17:70031925-70031947 GAAAACGGCCTAATACATCTGGG - Intergenic
1151039272 17:70839879-70839901 GAAAACAGACTAATACAGATGGG - Intergenic
1151143439 17:72016984-72017006 GAAAACAGACTAATACACCATGG - Intergenic
1151172761 17:72261495-72261517 GAGAACAGACTAATACAGGTGGG - Intergenic
1151280545 17:73070942-73070964 GAAAATGAACTAATACACCTAGG + Intronic
1151350667 17:73530158-73530180 GAAAATGGACTAATGCAGGAGGG - Intronic
1151874843 17:76861860-76861882 GAAAACAGACTAATACAGCCAGG - Intergenic
1152010070 17:77707560-77707582 GAAAACGGACTAATACACTTTGG + Intergenic
1152148508 17:78584131-78584153 CAAAATGGACTAACACAGGCTGG + Intergenic
1152160707 17:78666906-78666928 GAAAAGGAATGAATACAGCTGGG - Intergenic
1152329878 17:79666432-79666454 GAAAACGGACTAATATGGGTGGG - Intergenic
1152348202 17:79767792-79767814 GAAAATGGACTAATATGGCTGGG - Intergenic
1152756503 17:82089231-82089253 GAAGGTGGACTAATACGGCCTGG - Exonic
1153064139 18:1025850-1025872 GAAAATGGCAGAATTCAGCTTGG - Intergenic
1153199523 18:2634313-2634335 GAAAACGGACTAATGCAGTCAGG + Intergenic
1153362749 18:4216004-4216026 GAGAATGGACTAATACATTTAGG - Intronic
1153840522 18:9003727-9003749 GAGAACAGACTAATACAGGTAGG + Intergenic
1154257725 18:12798616-12798638 GAAAATGTACATATACAGCATGG - Intronic
1154271436 18:12923807-12923829 AATAAGGGACTAATACATCTTGG - Intronic
1155293995 18:24369115-24369137 GAAAATGGACTAATACGATTTGG + Intronic
1155400448 18:25433058-25433080 GAGAATGGTCTAATACAGTGGGG + Intergenic
1155746719 18:29363034-29363056 GAAAATGGATGAATACAGTGGGG + Intergenic
1155767048 18:29649009-29649031 GAAAATAAACTAATACAGGAAGG + Intergenic
1155918380 18:31578150-31578172 GAAAATGAACAAATGCAGGTGGG + Intergenic
1155980324 18:32172811-32172833 AAAAATTGACTGATATAGCTAGG - Intronic
1156117303 18:33801711-33801733 GAGAATGGGCTAATACAACTGGG - Intergenic
1156182598 18:34622991-34623013 GAACCTTGACTAATACAGATGGG + Intronic
1156568071 18:38218945-38218967 GAGAATGGACTAATACACCAGGG + Intergenic
1156644932 18:39149507-39149529 GAGAATGGACTAATACATATGGG - Intergenic
1156651280 18:39229181-39229203 GAAAATAGACTAATACAAAAGGG + Intergenic
1156687304 18:39665972-39665994 GAGAATGGACTAATACAGAGAGG - Intergenic
1156769295 18:40699434-40699456 GAAAATGGACCAATACAACTGGG + Intergenic
1156836515 18:41561639-41561661 AAAAATAGACTAATACAGATGGG + Intergenic
1156969147 18:43133890-43133912 GAAAATGAATGAATACAGTTAGG + Intergenic
1157136586 18:45062922-45062944 GAAAAAGGAATAATGCATCTTGG + Intronic
1157234439 18:45950605-45950627 GAAAAAGGACTAATACATTTGGG + Intronic
1157378002 18:47183479-47183501 GAAAAGGGACTAATACACGCTGG + Intergenic
1157454303 18:47812415-47812437 GAGATCAGACTAATACAGCTGGG + Exonic
1157698904 18:49747012-49747034 GAAAATGGACTAATACAGGAGGG + Intergenic
1157718533 18:49906073-49906095 GAAAAGAGACCAATACAGCCTGG - Intronic
1157875553 18:51270175-51270197 GAAAATGAACTAATACAAGAGGG - Intergenic
1157875597 18:51270486-51270508 GAAAATGAACTAATACGGCCGGG - Intergenic
1158035612 18:53026011-53026033 GAAAATGTTCCAATTCAGCTTGG + Intronic
1158092043 18:53726430-53726452 GAGAACAGACTAATACACCTAGG - Intergenic
1158130101 18:54142937-54142959 GAAAATAGACTAATACAACTGGG + Intergenic
1158623978 18:59056190-59056212 GAAAACGGACTAATGCAGAGGGG - Intergenic
1158628869 18:59094993-59095015 AAAAACAGACTAATACACCTTGG - Intergenic
1158727766 18:59989804-59989826 AGAAATGGACTAATACACCAGGG + Intergenic
1158855570 18:61540341-61540363 GAAAATGGACTAATACATGAAGG - Intronic
1158879966 18:61768635-61768657 AAAAATGGACTGATACACCAAGG + Intergenic
1159077581 18:63699347-63699369 GAAAATGAACTAATACAATTAGG - Intronic
1159131292 18:64282467-64282489 GAAAATGGATTAATACAGGTGGG + Intergenic
1159160028 18:64631915-64631937 CAGAATGGCCTAATACAGCTAGG + Intergenic
1159585950 18:70283832-70283854 GAAAAGGGACTAAGACAGGAGGG + Intergenic
1159711203 18:71763216-71763238 GAAAATGAACTAATACAAGACGG - Intronic
1159749572 18:72283531-72283553 GAAAATGGACTAATACAGAAAGG - Intergenic
1159799538 18:72880299-72880321 GAAAATGGACTTATACAGTTGGG + Intergenic
1159996438 18:74969894-74969916 GCAAACGGACTAATACAGTGGGG - Intronic
1160244238 18:77144469-77144491 GAAAACGGACTAATACGCTTTGG + Intergenic
1160290291 18:77586808-77586830 GAAAATAGACTAATACACCTGGG + Intergenic
1160546907 18:79664095-79664117 GAGAATGGACTAATACAATAGGG - Intergenic
1160612453 18:80099064-80099086 TAAAATGGACTAATACAAACTGG - Intergenic
1161371390 19:3913877-3913899 GAAAACAGACTAATACGGCGGGG - Intronic
1161997708 19:7724045-7724067 AAGAATGGCCTAACACAGCTGGG - Intergenic
1162302685 19:9852981-9853003 GAAAATGGAAAAATTCAGCTGGG + Intergenic
1164577242 19:29412706-29412728 GAAAATGGACTAATACACTTGGG + Intergenic
1165145505 19:33727577-33727599 CAAAATGGATTAATAAAGCCAGG - Intronic
1165259447 19:34599331-34599353 GAAAAGAGACTAATACAGATGGG - Intronic
1166263074 19:41656656-41656678 GAAAATGGACTAATACAGATAGG - Intronic
1166314197 19:41979600-41979622 AAAAATGGAAGCATACAGCTGGG - Intronic
1166657945 19:44626058-44626080 GAAAATGGACTACCATGGCTTGG + Intronic
1166914126 19:46182979-46183001 GAGAATGGAGTAATACAGTCTGG - Intergenic
1166968755 19:46547877-46547899 GAAAATGGTCTAATACACCAGGG + Intronic
1167403645 19:49289672-49289694 GAAAATGAACTAATACAGACTGG + Exonic
1167815687 19:51878960-51878982 AAAAATGTAATAATACGGCTGGG + Intronic
1167837565 19:52086574-52086596 AAGAATGGACTAATACAGTGGGG + Intronic
1167842425 19:52132815-52132837 CAGAATGGACTAATACAGTGGGG + Intronic
1168387570 19:55978350-55978372 GAAAACAGACTAAGACAGATAGG - Intronic
924972475 2:141609-141631 GAGAATGGACTAATACACTGTGG - Intergenic
925118921 2:1402477-1402499 GAAAATGGACTAATTCACTGAGG - Intronic
925205562 2:2003036-2003058 GAGAATGGACTAATATACCTTGG + Intronic
925261484 2:2532109-2532131 GACAATGGACTAACACAGTGGGG + Intergenic
925437116 2:3848040-3848062 GAGAACAGACTAATACAGCTGGG + Intergenic
925440877 2:3884039-3884061 GAAAATGGACTAATATAACCTGG - Intergenic
925475568 2:4210719-4210741 GAAAACGGACTAATACACCTGGG - Intergenic
925507102 2:4579361-4579383 GAAAAGGGACTAAGACAACAAGG - Intergenic
925612354 2:5712347-5712369 GAGAATGGACTTATACACTTTGG - Intergenic
925857595 2:8145354-8145376 AAAAATGGACTAATACACCAAGG - Intergenic
925876566 2:8316348-8316370 GAAAATGGACTAATGCATGAAGG - Intergenic
925907837 2:8549953-8549975 CAAAATGGACTAACACAGTTGGG + Intergenic
926186569 2:10695479-10695501 GAGAATGGACTGAGACACCTGGG + Intergenic
926506369 2:13721328-13721350 GAAAAGAAACTAATACACCTGGG - Intergenic
926629697 2:15125160-15125182 GAGAACAGACTAATACAGGTGGG - Intergenic
926729535 2:16025788-16025810 GAAAACGGACTAATACATATGGG - Intergenic
927098764 2:19770525-19770547 GAAAATGGACTAATACAACATGG - Intergenic
927106710 2:19833993-19834015 GAGAATGGACTCATACAAGTGGG - Intergenic
927347661 2:22065347-22065369 GAAATTGGACTATTTCACCTAGG - Intergenic
927398079 2:22678503-22678525 GAATATGCACTGATACAGCCAGG + Intergenic
927403299 2:22739632-22739654 CAAAATGGACTAATACACTGTGG - Intergenic
928045870 2:27931130-27931152 GAAAATGGTCTAATAATGCAAGG - Intronic
928054071 2:28033302-28033324 GAAAATGGACTAAGACACACTGG - Intronic
928133790 2:28672852-28672874 GAGAATGGACTAATACAGCATGG + Intergenic
928396502 2:30946670-30946692 TAGAATGGACTGATACAGCTGGG + Intronic
928749682 2:34457355-34457377 GAGAATGGACTAATACAGAGAGG - Intergenic
928823095 2:35387021-35387043 GAAAATGGACTAATACAATGAGG - Intergenic
928848955 2:35718313-35718335 GAGAATGAACTAATACAGCATGG + Intergenic
929010455 2:37437890-37437912 GAAAATTGACTGATACAGATGGG - Intergenic
929019724 2:37539491-37539513 GAGAACAGACTAATACACCTGGG + Intergenic
929190132 2:39132068-39132090 GAACACTGACTAATACAGATTGG + Intergenic
929222424 2:39478200-39478222 GAGAATGGACTAATACAAGGGGG + Intergenic
929273982 2:40005753-40005775 GAAAATGGACTAATACACCAGGG - Intergenic
929396647 2:41531396-41531418 TAAAATGAACTAATACACCGGGG - Intergenic
929417517 2:41758775-41758797 GAAAATTGACTAATGCAGTATGG - Intergenic
929714978 2:44301089-44301111 GACCATGGACCAATACAGCACGG + Exonic
929759067 2:44791104-44791126 GAAAATGGACTAATACAATCAGG - Intergenic
929773253 2:44910928-44910950 GAGAATGGACTAATACATTCTGG - Intergenic
929812136 2:45199711-45199733 CAAATTGGACTAAGACATCTTGG + Intergenic
930309798 2:49726276-49726298 GAAAATGGCCTAATACAGGTGGG - Intergenic
930427681 2:51233143-51233165 GATAATGGACTAATACAGATAGG - Intergenic
930438623 2:51378241-51378263 GAGAATGGACTAATACAGGAAGG + Intergenic
930457351 2:51622299-51622321 GAAAATGGACTAATACATATAGG - Intergenic
930979336 2:57503761-57503783 GAGAACAGACTAATACAGCAGGG - Intergenic
930990003 2:57641943-57641965 GAAAATTGACTAGTAGAGCTAGG + Intergenic
931112032 2:59121436-59121458 CAAAATGGACTAACACAGTAGGG + Intergenic
932061033 2:68497618-68497640 GAAAACAGACTAATACAGTGTGG + Intronic
932267858 2:70383679-70383701 GAAAATGAACTAATACAAGAAGG + Intergenic
932657472 2:73622669-73622691 GAAAATGGACTAATACACATGGG + Intergenic
932664138 2:73682936-73682958 GAAAATGGACTAATACACATGGG + Intergenic
932879451 2:75487292-75487314 GAAAACAGAATAATACAGGTTGG + Intronic
933296048 2:80492405-80492427 GAGAATGGACTCATACAGATGGG + Intronic
933716304 2:85363589-85363611 GAAAACGGACTAATACAATGGGG - Intronic
933943834 2:87267356-87267378 GAAAATGGACTAACACAACAGGG + Intergenic
934311440 2:91869717-91869739 GAAAATGGACTAATTCAATGTGG - Intergenic
934473239 2:94574635-94574657 GAGAACAGACTAATACAGCATGG + Intergenic
934482301 2:94662992-94663014 GAAAACAGACCAATACAGCTAGG - Intergenic
934926654 2:98386619-98386641 GAGAACAGACTAATACAGGTAGG + Intronic
935026980 2:99286278-99286300 GAAAACAGACTAAGACAACTAGG + Intronic
935832220 2:107011958-107011980 GCGAATGGACTAATACAAGTGGG + Intergenic
936336386 2:111594223-111594245 GAAAATGGACTAACACAACAGGG - Intergenic
936658245 2:114513225-114513247 GAAACTGGACCTTTACAGCTGGG + Intronic
936661199 2:114546103-114546125 AAAAATGGACTGATACAGGGGGG - Intronic
936731229 2:115383479-115383501 GAAAATGGACTAATAGAAGTGGG + Intronic
936855500 2:116953071-116953093 GAGAACGGACTAATACAGTTTGG - Intergenic
936936997 2:117848255-117848277 GAAAATGGACTAAAACAGGGAGG + Intergenic
937345012 2:121120027-121120049 GAAAATGGACTAATACAGTAGGG - Intergenic
937448453 2:121978651-121978673 GAAAATGGACTAATACACCTGGG - Intergenic
937777943 2:125803536-125803558 GAGAATGGACTAATACAGATGGG - Intergenic
938216211 2:129518912-129518934 GAGAATGGACCAATACACCAGGG - Intergenic
938336584 2:130505592-130505614 AAAAATGGATGAACACAGCTTGG + Intronic
938353234 2:130615070-130615092 AAAAATGGATGAACACAGCTTGG - Intronic
938411283 2:131066842-131066864 GAGAATGAACTAATACAACTGGG - Intronic
938816349 2:134908562-134908584 AAAACTGGACTAAAACAGCAGGG - Intergenic
938982032 2:136536226-136536248 GAAAACAGACTAATACAGGTGGG - Intergenic
939242071 2:139573777-139573799 GACAATGGACTAACACATCAAGG + Intergenic
939346929 2:140977416-140977438 GAAAATGGACTAATACATATGGG + Intronic
939835362 2:147123963-147123985 GAGAACAGACTAATACAGGTAGG - Intergenic
939866231 2:147475669-147475691 TGAAACGGACTAATACAGATGGG - Intergenic
940064126 2:149607736-149607758 GAAAACAGGCTAATACAGGTGGG + Intergenic
940174585 2:150864162-150864184 GAAAATGGAATAATACATGGGGG - Intergenic
940425819 2:153531134-153531156 AAAAATGAACTGATACAGATGGG - Intergenic
940720993 2:157281377-157281399 AAAAATGGCCTAATACACCAAGG + Intronic
940723100 2:157303450-157303472 GAAAATGAAATAATACAACATGG + Intronic
941057484 2:160805801-160805823 GAAAATGGACTAATACAGATAGG - Intergenic
941503297 2:166308625-166308647 AAAAATGGACTAATACGGCCGGG + Intronic
941946981 2:171110172-171110194 GAAAATGGACTAAAAAGGCCAGG + Intronic
942339912 2:174932936-174932958 GAGAACAGACTAATACAGTTAGG + Intronic
942557410 2:177186119-177186141 GAAAACAGACTAATACAGTTTGG - Intergenic
942845346 2:180417684-180417706 GAAAATGGACTAATACAGTGAGG + Intergenic
943072020 2:183152891-183152913 GAATAGGGACTAATACAGTATGG - Intronic
943245830 2:185450288-185450310 GAAAATATTCTAATACGGCTGGG - Intergenic
943438077 2:187892134-187892156 GAAAACAGACTAATACACTTGGG + Intergenic
943491473 2:188560071-188560093 GAAAGTGGACTAATACAGTGAGG + Intronic
943555129 2:189393975-189393997 GAAAATGGCCTACAACAGATGGG - Intergenic
943568677 2:189546327-189546349 GAGAATGGACTAATACAAAGTGG - Intergenic
943636129 2:190308754-190308776 GAAAATGGACTAACACAGTTAGG + Intronic
943778532 2:191794955-191794977 GAGAATGGACTAACACAGTAAGG - Intergenic
943788318 2:191902544-191902566 GAAAACGGACTAATACAAGTAGG + Intergenic
943880849 2:193141992-193142014 GAAAATGGACTAATACTCCAAGG + Intergenic
943907396 2:193517156-193517178 GCAAATGAACTAATACATATAGG - Intergenic
943978023 2:194508926-194508948 GAAAATAGATTAATACAGTTGGG - Intergenic
944386289 2:199168568-199168590 GAAAATGGACTAATACATTTGGG + Intergenic
944578271 2:201110935-201110957 CAAAACAGACTAAGACAGCTGGG - Intergenic
944827826 2:203503276-203503298 GAAAACAGACTAATACAGATGGG - Intronic
944855407 2:203762426-203762448 GAGAATAGACTAATACAGTTGGG + Intergenic
945157873 2:206858612-206858634 GAAAACAGACTAATACACCTTGG + Intergenic
945347325 2:208733392-208733414 GATAACGGACTAATACAGTATGG - Intronic
945347931 2:208740616-208740638 GAAAATGAACTAATTTAGCAAGG + Intronic
945358039 2:208861503-208861525 GAAAATGGACTAATACACTTGGG + Intergenic
945570397 2:211459783-211459805 GAAAATGGACTAATACAGGAGGG + Intronic
945739344 2:213641728-213641750 GACAATGGACTAATACACTCAGG - Intronic
945792339 2:214320466-214320488 GAAAATGGACTAATACAACCAGG - Intronic
945892992 2:215450217-215450239 GACAATGGACTAATACAATTGGG - Intergenic
946023152 2:216655601-216655623 GAAAATGGACTAATACAGTCAGG + Intronic
946146425 2:217734618-217734640 GAAAAAGGATTAATACAGTTGGG - Intronic
946169913 2:217888844-217888866 GAAAATGGACTAATACACCAGGG + Intronic
946407721 2:219500847-219500869 GGAAATGGATTAATGCAGCTTGG + Intronic
946531380 2:220574063-220574085 GAAAATGGACTAATACAGAAGGG - Intergenic
946561718 2:220921534-220921556 GAGAATGGACTAATATATCAAGG - Intergenic
946665569 2:222046317-222046339 CAAAATGGACTAAAACAGAAGGG + Intergenic
946729348 2:222693471-222693493 GAAAATGAACTAATACAAAATGG - Intronic
946832031 2:223736941-223736963 GAAAATGGACTAATACATAAAGG + Intergenic
947208098 2:227680920-227680942 GAGAACAGACTAATACAGGTTGG - Intergenic
947341457 2:229143946-229143968 GAAAATGGACTAATACAGGGGGG + Intronic
947381858 2:229552752-229552774 GAAAACTGACTAATACAGGTGGG + Intronic
947458938 2:230285713-230285735 GAAAATGTATTAATAGAACTGGG - Intronic
947466438 2:230352242-230352264 GAGAATGAACTAATACACCAAGG - Intronic
947469220 2:230385185-230385207 GAAAATGTATTAATAGAACTGGG - Intronic
947527656 2:230889051-230889073 GAACATGGACTAATACAGAGAGG - Intergenic
947777133 2:232722164-232722186 GAAAATGGGCTAATACAAGAGGG - Intronic
947782841 2:232785142-232785164 CAAAATGGACTAATAAACCAAGG + Intronic
948240721 2:236431207-236431229 GAGAATGGACTAATACACCTGGG - Intronic
948299437 2:236890965-236890987 GAGAACGGACTAATACAGATGGG + Intergenic
948310704 2:236983814-236983836 GAAAATGGACTAATACAACCAGG + Intergenic
948551264 2:238774446-238774468 GAAAATGGACTAATACAGCAGGG - Intergenic
948810991 2:240478280-240478302 GAGAATGGACTAATACAGTGCGG + Intergenic
1168827963 20:826678-826700 GAAAACGAACTAATACAGCACGG + Intergenic
1169052523 20:2592995-2593017 GAACATGAACTAATACAATTGGG - Intronic
1169395094 20:5221982-5222004 GAAAATGGACTAAGGCACCTGGG + Intergenic
1169498165 20:6134294-6134316 GAAAATGAACTAATACACCCTGG + Intergenic
1169522323 20:6387065-6387087 GAGAATGAACTAATACAGGAAGG + Intergenic
1169681413 20:8218039-8218061 CAACATGGACTAAGACAGGTGGG + Intronic
1169726275 20:8736501-8736523 GAAAATGGACAAACACAGGTTGG - Intronic
1169740878 20:8893063-8893085 GAAAATGGAATAAATCAACTGGG - Intronic
1169770088 20:9190553-9190575 GAGAACAGACTAATAGAGCTGGG + Intronic
1170048020 20:12108350-12108372 GAGAATGGACTAATACGACTGGG - Intergenic
1170213923 20:13872588-13872610 GAGAACGGACTAATACAGAAGGG + Intronic
1170414701 20:16127304-16127326 GAAAATGGACTCAGACACTTGGG + Intergenic
1170627836 20:18043002-18043024 CAAAATGGACTAAGACAGCATGG + Intronic
1170797126 20:19557800-19557822 GAAAGTGGACAAGTTCAGCTTGG - Intronic
1171037340 20:21726204-21726226 GAAAATGGACCAAGACAGGAAGG - Intergenic
1171091901 20:22293267-22293289 GAAAATGGAATAATACAGAAGGG + Intergenic
1171092085 20:22294785-22294807 GAAAATGGACTAATACAGAAGGG + Intergenic
1172671007 20:36634442-36634464 GAATATGCACTAATAGAGCCAGG - Intronic
1172909968 20:38401346-38401368 GAAAATGGACAAATACACTATGG - Intergenic
1173097348 20:40048262-40048284 CAAAATCGACTAAGACACCTTGG - Intergenic
1173172196 20:40736453-40736475 GAGAATGGACTAATACAGCAAGG - Intergenic
1173185192 20:40835015-40835037 GAAAAAGTAATAATACAGGTTGG + Intergenic
1173252690 20:41373030-41373052 GAAAATGGACTAATATACAGGGG + Intergenic
1173264042 20:41461678-41461700 GAAAATGAACCAATACATCCTGG + Intronic
1173317958 20:41961845-41961867 GAGAACAGACTAATACAGCTAGG + Intergenic
1173492917 20:43497921-43497943 GAAAACAGACTAAGACAGGTGGG + Intergenic
1173593699 20:44245323-44245345 GAGAATGGTCTAACACAGCTGGG - Intergenic
1173964715 20:47103425-47103447 GAAAATGGACTAATACACAATGG - Intronic
1174285879 20:49472995-49473017 CAAAATGGACTAATACAGATAGG + Intronic
1174919557 20:54687050-54687072 GAAAATGGACTAAGACAGTCTGG + Intergenic
1174992545 20:55527217-55527239 GAGAAGGGAGTAATACACCTGGG + Intergenic
1175024236 20:55884788-55884810 GAAAACAGACAAATACAGATGGG + Intergenic
1175317739 20:58062316-58062338 GAAAAGGAAATAATAAAGCTAGG + Intergenic
1176424062 21:6536980-6537002 GAAAACGGACTAATATACCCAGG + Intergenic
1177084236 21:16682172-16682194 GAGAATGGACTAATACACTGTGG - Intergenic
1177185150 21:17785461-17785483 TAAAATAGACTAAGACAGGTAGG - Intergenic
1177392563 21:20495360-20495382 GAGAATGGATTAATACAGGCAGG - Intergenic
1177484301 21:21737163-21737185 GAGAACGGCCTAATACAGGTGGG - Intergenic
1177784259 21:25653395-25653417 GAAAACAGACTAATACACCAGGG - Intronic
1177822396 21:26045821-26045843 GCAAATGAACTAATACAGCTCGG - Intronic
1177925701 21:27211808-27211830 GAAAATGGACTAATACACAAGGG + Intergenic
1178028567 21:28496820-28496842 GAGAACAGACTAATACAGCTGGG - Intergenic
1178093059 21:29184404-29184426 CAAAATGGACTAAGACAGTAGGG + Intergenic
1178099425 21:29252140-29252162 GAAAATGGACTAATATACTTGGG - Intronic
1178122637 21:29484876-29484898 AAAAACGGACTAATACAACAGGG - Intronic
1178221071 21:30660885-30660907 GAAAATGGACTAATACATGCAGG - Intergenic
1178374719 21:32057212-32057234 GAGAACGGACTAATACAGTAAGG - Intergenic
1178481980 21:32987358-32987380 GATAATGAACTAATACACCCAGG - Intergenic
1178623151 21:34193916-34193938 GAAAATGGACTAATACAGACAGG + Intergenic
1178673173 21:34610052-34610074 GAAAATGGCCTAAAACTGCCTGG + Intronic
1178683681 21:34694748-34694770 GAGAATGGACTAATACACCTTGG + Intronic
1178694648 21:34782258-34782280 GAAAACAGACTAATACAGACTGG + Intergenic
1178740306 21:35193893-35193915 GAAAATGGACTAATACAGATGGG - Intronic
1179289408 21:40005743-40005765 GAAAATGGACTAAGACCGAAGGG + Intergenic
1179322180 21:40302505-40302527 AAAAATGGACTAATACAGAGCGG + Intronic
1179337448 21:40471009-40471031 GAAAATGGAATATGACAGCTAGG - Intronic
1179439697 21:41384281-41384303 GAGAACGGACTAATACAGGTGGG + Intronic
1179461584 21:41538914-41538936 GAACCTGGACTCATACAGGTCGG + Intergenic
1179561008 21:42216255-42216277 GAAAATGGACTAATACAGACAGG + Intronic
1179699555 21:43145295-43145317 GAAAACGGACTAATATACCCAGG + Intergenic
1180307600 22:11142452-11142474 GAAAACGGATTGATACAGTTTGG - Intergenic
1180546120 22:16504675-16504697 GAAAACGGATTGATACAGTTTGG - Intergenic
1180686332 22:17669960-17669982 GAAAATGGACTAATACACATGGG + Intronic
1180756806 22:18168066-18168088 GAAAATGGACTAACACATACAGG - Intronic
1181074961 22:20369377-20369399 GAAAATGGACTAACACATACAGG + Intronic
1181393136 22:22598574-22598596 GAACATGGACTAAAACACCAGGG - Intergenic
1182213060 22:28692714-28692736 GAAAACGGATTGATACAGTTTGG + Intronic
1182330000 22:29544979-29545001 GAAAATGGACTAATGCAGATGGG - Intronic
1182364749 22:29770980-29771002 GAAAATGGACTAATACACAAGGG + Intergenic
1183014514 22:34974812-34974834 GAGAAAGGACTAATACAAATGGG - Intergenic
1183536794 22:38406644-38406666 GAAAAAAGAGAAATACAGCTGGG - Intergenic
1184007131 22:41718639-41718661 TAAAATGCACTAAGACACCTAGG - Intronic
1184312096 22:43652464-43652486 GAAAACGGACTGATACACCCAGG + Intronic
1184386262 22:44176722-44176744 GAGAATGGATTAATACACATAGG - Intronic
1184386408 22:44178178-44178200 GGAAATGGACTAATACACATAGG + Intronic
1184822836 22:46923536-46923558 GAAGAAGGACTCATCCAGCTTGG + Intronic
1185156802 22:49197966-49197988 GAAACTGGTCTAATACAGGATGG - Intergenic
949103942 3:180683-180705 GAAAATGGTAGAATATAGCTAGG + Intergenic
949204045 3:1416896-1416918 GAGAACAGACTAATACAACTGGG - Intergenic
949363156 3:3253086-3253108 GAAAACGGACTAATACAGTGTGG - Intergenic
949463952 3:4324850-4324872 GAAAATGGGATAATACAGGGGGG - Intronic
949575031 3:5330885-5330907 GAAAATGGACTGATACAGGAGGG - Intergenic
949693128 3:6663336-6663358 GAAAACAGAGTAATACGGCTGGG - Intergenic
950146184 3:10651590-10651612 GAAAATGGAGTAACACAGATGGG + Intronic
951104121 3:18723468-18723490 GAAAATGGATTAAGACACATGGG - Intergenic
951180477 3:19653565-19653587 GAAAATGGACTAACCCAATTTGG - Intergenic
951299890 3:20983371-20983393 GAAAATGGAATAATAGAATTAGG + Intergenic
951624765 3:24647036-24647058 GAAAATGAACTAAGACAAGTAGG - Intergenic
951693108 3:25417696-25417718 GAAAATAGACTAATACAGCCTGG + Intronic
951953178 3:28224443-28224465 GAAAATGGACTAATACAAGTGGG - Intergenic
952080898 3:29756314-29756336 GAGGATGGACTAATACACCTGGG - Intronic
952221224 3:31326222-31326244 GAGAATGGACTAATACAATGTGG - Intergenic
952611345 3:35214580-35214602 GAAAATGAACTAATACAATATGG - Intergenic
953034336 3:39198909-39198931 GAAAATGGACTAAGACAATGGGG + Intergenic
953073565 3:39547303-39547325 GAGAATGGACTAATACAGGGAGG + Intergenic
953456607 3:43047308-43047330 GAGAATGGACTAATACAGGTGGG + Intronic
954591735 3:51788997-51789019 GAAAATGAGCTAATACAGGTAGG + Intergenic
955146733 3:56327109-56327131 GAAAATGGACTAATACACATTGG - Intronic
955217502 3:56996698-56996720 TCAAATGGACTAAGACAGCAAGG + Intronic
955471728 3:59293826-59293848 GAAAATAGACTAATACACCAAGG - Intergenic
955820425 3:62890667-62890689 GAAAATGGACTAATACAATGGGG - Intergenic
955868886 3:63416585-63416607 GAAAACGGACTAATACACTGAGG - Intronic
955902998 3:63777195-63777217 CAAAATGGACTAACACAGATAGG + Intergenic
955970841 3:64436773-64436795 AAAAATGGACTAATACAGTGGGG + Intronic
956256461 3:67288309-67288331 GAAAACAGACTAATACAATTAGG + Intergenic
956268345 3:67423393-67423415 GAGAATGGACTAATACACCTAGG + Intronic
956291879 3:67669014-67669036 GAAAAGGGACTAATACATGGGGG + Intergenic
956292641 3:67677546-67677568 GAACCTAGACTAATACAGCTGGG + Intergenic
956418005 3:69053135-69053157 CCAAATGGACTAAGACACCTAGG + Intergenic
956855993 3:73275378-73275400 GAAAATGGACTAATACAATGTGG - Intergenic
957020255 3:75118533-75118555 GAAAATGGACTAATCCAGTGGGG - Intergenic
957166167 3:76676469-76676491 GAAAACGGACTAATACAACAAGG + Intronic
957434342 3:80154275-80154297 AAGAATGGACTAATACATCTGGG + Intergenic
957555305 3:81759169-81759191 GAAAACGGACTAATACAGAAGGG + Intronic
957561441 3:81826810-81826832 GAAAACGGACTAATGCAACATGG + Intergenic
957606316 3:82403854-82403876 GAAAAAGAACTGATACAGGTAGG + Intergenic
957767746 3:84648120-84648142 GGAAATGAATTAATACACCTGGG - Intergenic
957831769 3:85530680-85530702 GAGAATGGATTAATACAGATAGG + Intronic
957983719 3:87545589-87545611 TAAATTGAACTAATACAGCAAGG - Intergenic
958543582 3:95511137-95511159 GAAAACATACTAATACAGTTGGG + Intergenic
958638364 3:96775140-96775162 GAAAATGGACTAATACAGGTGGG - Intergenic
958710514 3:97711359-97711381 GAAAATGGACTAATACAGTCAGG + Intronic
958799487 3:98738602-98738624 GAGAATGAACTAATACAGATGGG + Intronic
958832887 3:99110999-99111021 GAGAACAGACTAATACATCTGGG - Intergenic
958837085 3:99158350-99158372 GGAAATGGACTACTACAGTGGGG + Intergenic
959027334 3:101255148-101255170 GAGAATGGACTAATACAAGGAGG + Intronic
959095345 3:101949591-101949613 GAACATGACCTAATATAGCTAGG + Intergenic
959214661 3:103436580-103436602 GAAAACGGACTAATACAGAGAGG - Intergenic
959269359 3:104186786-104186808 GAGAATGAAATAATAGAGCTTGG - Intergenic
959346439 3:105201014-105201036 GAGAATGGACTAATACAAAAGGG - Intergenic
959472813 3:106773566-106773588 GAACCCTGACTAATACAGCTGGG + Intergenic
960143370 3:114172746-114172768 CAAAATGGACTAAGATAGATGGG - Intronic
960359077 3:116688943-116688965 GAGAATGGACTAATACACTTAGG - Intronic
960462360 3:117952001-117952023 GAGAATGAACTAATACAGATGGG + Intergenic
960495375 3:118367559-118367581 GAGAATGGACTAATACAATAAGG - Intergenic
960535436 3:118809852-118809874 GAAAATGGACTAATACAGACAGG - Intergenic
960665361 3:120103892-120103914 GAAAAGGAACTACTACAGCAAGG - Intergenic
961064305 3:123861597-123861619 GTAAATGGCCAAAGACAGCTTGG - Intronic
961342983 3:126242144-126242166 GAAAATGGACTAATAAATATTGG + Intergenic
961413782 3:126742864-126742886 GAAAATGGACTAAGATATTTGGG + Intronic
962099103 3:132323124-132323146 GAAAATGGGCTAAGACAGAGGGG + Intronic
962157832 3:132967547-132967569 GAAAATGGATTAATACAGTGAGG - Intergenic
962162007 3:133010603-133010625 GAAAATGAACTAATACACACAGG - Intergenic
962322500 3:134403449-134403471 GAAAATGAACTAATACACCATGG + Intergenic
962324565 3:134422669-134422691 AAGAATGGCCTAATACACCTGGG + Intergenic
962509658 3:136085449-136085471 GAGAACAGACTAATACAGATGGG + Intronic
962888290 3:139648376-139648398 GAAAATGGACTGATATATGTAGG + Intronic
963003913 3:140708171-140708193 CAAAATGGACTAAGACAGAAAGG + Intergenic
963267148 3:143250760-143250782 GGAAATGGACTAATACACAAGGG + Intergenic
963275170 3:143322580-143322602 GAAATTTGACTAATACAACCAGG + Intronic
963339606 3:144019089-144019111 GAGAATGGACTAATATAGCTGGG - Intronic
963347988 3:144118855-144118877 GAAAATGGTCTAATACAAATAGG + Intergenic
963471466 3:145747419-145747441 GAAAATGAACTAATACAGCATGG - Intergenic
963478739 3:145840526-145840548 GAAAATCGACTATTACAGCTAGG - Intergenic
963521095 3:146360783-146360805 AAGAATGGACTGATACACCTAGG + Intergenic
963654128 3:148024037-148024059 CAAAATGGACTAACACAGACTGG - Intergenic
963675050 3:148300189-148300211 GAGAATGGACTAATATAGTCTGG - Intergenic
963867639 3:150379525-150379547 GAAAATGGACTACTACAGGAGGG + Intergenic
963878112 3:150499828-150499850 GAGAATGGGCTAATACAGAGAGG - Intergenic
963898427 3:150710665-150710687 ACAAATGGACTAAGACAGGTAGG + Intergenic
963916521 3:150863964-150863986 GAAAATGGACTAATACACCCAGG - Intergenic
963955437 3:151248510-151248532 TAAAGTGGACCAGTACAGCTGGG - Intronic
964600182 3:158491935-158491957 GAAAATGGACTAATACACACAGG - Intronic
964605925 3:158559898-158559920 GAAAACAGACTAATACAAATAGG + Intergenic
964645918 3:158958530-158958552 GAGAATGGACTAATATAGAGTGG - Intergenic
964654715 3:159053151-159053173 GAAAACGAACTAATACACCTGGG + Intronic
964820313 3:160761666-160761688 GAAAACGGGCTAATACAAATGGG - Intronic
964912452 3:161799781-161799803 GAAAATGGACTAATAAAAAAGGG - Intergenic
965045642 3:163573444-163573466 GAAAATGGACTAACGTAACTTGG + Intergenic
965152906 3:165005208-165005230 GAAAATAGACTAATACAGCAGGG + Intronic
965387052 3:168057307-168057329 GAAAATGAAATAATACACCCTGG + Intronic
966314651 3:178632308-178632330 GAGAATGGACTAATACACCATGG - Intronic
966627708 3:182036634-182036656 GAAAATGGACTAATACAGAAAGG - Intergenic
966799297 3:183748059-183748081 GAGAATGGACTAACACAGAAAGG - Intronic
966824557 3:183952825-183952847 AAAAATGGACTAATACACAACGG + Intronic
967558778 3:190894013-190894035 GAGAATGAACTAATACAGGCAGG - Intergenic
967595620 3:191324345-191324367 GAAAATAGAGTAAGACAGATGGG + Intronic
968789896 4:2652368-2652390 AAGAATGGACTAATACACCAGGG - Intronic
968937380 4:3618610-3618632 GAGAAAGGACTAATACACCATGG - Intergenic
969074861 4:4569901-4569923 GAAAACAGACAAATACAGATAGG - Intergenic
969075511 4:4575021-4575043 GAAATTGAACTAATTCAGCCAGG + Intergenic
969081753 4:4624539-4624561 GAAAACAAACTAATACAGATGGG - Intergenic
969090075 4:4687230-4687252 GGAGATGGCCTAATACAGCAAGG - Intergenic
969107240 4:4816911-4816933 GAGAATGGACTAATACACACAGG + Intergenic
969135603 4:5026301-5026323 GAGATTGGACTAATACAACTGGG - Intergenic
969144852 4:5113723-5113745 GAAAATAGACTAGTACAGGTAGG - Intronic
969333208 4:6491946-6491968 GAGAACAGACTAATACAGCCGGG + Intronic
969390959 4:6891013-6891035 GAGAATGGCCTAATACAGGGTGG - Intergenic
969504760 4:7578356-7578378 CAAAATGGACTAAGACAGGTGGG + Intronic
969667506 4:8569021-8569043 AAAAATGCACTAATACGGCCTGG - Intronic
969863478 4:10055984-10056006 GAAAACAGACTAATACAAGTGGG + Intergenic
969948938 4:10813753-10813775 GAAAATGGACTAAAACAGGTAGG - Intergenic
970094307 4:12445249-12445271 GAAAATGGACTAATAAGGCCGGG - Intergenic
970261782 4:14232148-14232170 CAATACTGACTAATACAGCTTGG + Intergenic
970279933 4:14443884-14443906 GAAAATGGACTAATACATCTGGG + Intergenic
970311927 4:14792225-14792247 GAGAATGGATTAATACAGTAGGG - Intergenic
970313532 4:14807782-14807804 GAAAAGGGACTAATACACCATGG - Intergenic
970502102 4:16688476-16688498 GAAAATGGAATAAAACAGAAAGG - Intronic
970528184 4:16954422-16954444 ACAAATGGACTAAGACATCTAGG - Intergenic
970567120 4:17342260-17342282 GAGAATGGACTAATACACTGAGG + Intergenic
970718641 4:18959263-18959285 GAAAATGGATGAATACAGAAGGG - Intergenic
970799703 4:19958120-19958142 GAAAATGGACTAATACACCCAGG - Intergenic
970991529 4:22218675-22218697 GAAAACAGACTAATACACCCAGG - Intergenic
971021839 4:22545206-22545228 GAAAATGTACTAATACAGGAGGG - Intergenic
971070128 4:23081462-23081484 GAAAATGGACTAATACAACTGGG + Intergenic
971263639 4:25078735-25078757 GAAAACAGACTAATACACCAGGG - Intergenic
971454805 4:26834271-26834293 GAGAATGGACTAATACAGGTTGG + Intergenic
971459422 4:26878648-26878670 GAAAATGAACTAATACAGATGGG - Intronic
971480734 4:27112873-27112895 GGAAATGGACTGATACAGGTGGG - Intergenic
971533169 4:27714847-27714869 GAAAACAGACTAATACAAGTTGG + Intergenic
971591490 4:28474347-28474369 GAAAGTGGACTAATATAGAAGGG + Intergenic
971670106 4:29545631-29545653 GAAAATAGACTAATACAATCAGG - Intergenic
971753469 4:30679434-30679456 GAAAGTGGACTAATTCAGATAGG + Intergenic
971791639 4:31177053-31177075 GAAAATGGAATAATAAGGCCAGG - Intergenic
971879404 4:32350650-32350672 GAAACTTGACTAACAAAGCTTGG + Intergenic
971901855 4:32670251-32670273 GAAAATGGACCGATATACCTAGG + Intergenic
971958310 4:33452423-33452445 GAAAAAGGACTAATACAGTGGGG + Intergenic
972124091 4:35741501-35741523 GAAAACGGACTAATAAAGGCAGG + Intergenic
972220451 4:36949149-36949171 GAGAATGGACTAATACAGATGGG - Intergenic
972296630 4:37745508-37745530 GAGAATAGACTAATACAGCAGGG - Intergenic
972664391 4:41150023-41150045 GAAAATGGACTAATACACTGGGG + Intronic
972744793 4:41922486-41922508 GAGAATGGACTAATATAGCAGGG + Intergenic
972792560 4:42387112-42387134 GAAAATGTACTAATACACCATGG - Intergenic
973334971 4:48946982-48947004 GAAAATGGACTAATACAGTTGGG - Intergenic
973669945 4:53206868-53206890 GAAAATGGACTAAGACAACCAGG - Intronic
973851570 4:54966297-54966319 GAGAAGGGATTAATACACCTGGG + Intergenic
974237470 4:59200200-59200222 AAAAATGGAATCAGACAGCTAGG - Intergenic
974465036 4:62244363-62244385 GAAAACAGACTAATACAAATGGG - Intergenic
974511294 4:62845358-62845380 GAAAATGGACTAATACAGATTGG - Intergenic
975213509 4:71728308-71728330 GAGAATAAACTAATACACCTGGG + Intergenic
975237191 4:72013304-72013326 GAGAATGGACTAATACAGCATGG - Intergenic
975253810 4:72211984-72212006 GAAAATGGACCAATACACCTGGG - Intergenic
975665249 4:76728563-76728585 GAGAATGAACTAATACATGTGGG + Intronic
975876026 4:78837969-78837991 GAAAATGGACTAATACAGCAAGG - Intronic
975919787 4:79371406-79371428 GAAAATGAACTAATACAGTTGGG - Intergenic
976259723 4:83134446-83134468 GAAAACAGACTAATACAAGTGGG - Intronic
976750477 4:88447275-88447297 GAGAACAGACTAATAGAGCTGGG - Intergenic
976892671 4:90069033-90069055 GAAAATGAACTAATACAGTATGG + Intergenic
977013949 4:91669451-91669473 GAAAATGGACTAATACATGAAGG - Intergenic
977015417 4:91686725-91686747 GAGAATGGACTACTACAGAGAGG - Intergenic
977099737 4:92795503-92795525 GAAAATGGACTAATGGAGAGAGG + Intronic
977351533 4:95894608-95894630 AAGAATGGACTAATACAAATGGG + Intergenic
977677606 4:99765134-99765156 CAAAATGGACTAATATAGTCAGG + Intergenic
977723923 4:100271804-100271826 GAAAATGGGCTAGTACAGGAGGG + Intergenic
977880915 4:102204676-102204698 GAAAATGGTCTAATACAGTCTGG - Intergenic
978029909 4:103928369-103928391 GAGAATGGACTAATACATAGAGG + Intergenic
978032857 4:103957350-103957372 GAAAATGGACTAACACAGAAGGG - Intergenic
978339329 4:107705574-107705596 GAAAACGAACTAATACAGACTGG + Intronic
978396026 4:108281074-108281096 GAAAATGGACTAATACACATTGG - Intergenic
978415790 4:108474622-108474644 GAGAATGGACTAATATAGTGGGG + Intergenic
978817594 4:112926838-112926860 GAGAATGGACTAATACAATATGG - Intronic
979090040 4:116471387-116471409 GAGAACAGACTAATACAACTTGG + Intergenic
979203284 4:118005021-118005043 GAGAATGGACTAATACACCCTGG - Intergenic
979410515 4:120373019-120373041 GAAAATGAACAAATATAGTTGGG - Intergenic
979447501 4:120832094-120832116 GAGAATGGACTAATAGAATTTGG - Intronic
979590274 4:122471010-122471032 GAGAATAGACTAATACACCATGG + Intergenic
979594523 4:122519542-122519564 GAAAATGGACTAAGAGGTCTAGG + Intergenic
979595290 4:122528075-122528097 AAGAATGGACTAATACAGGAGGG - Intergenic
979810297 4:125028407-125028429 GAAAATGGACTGACACATCATGG - Intergenic
979856040 4:125636131-125636153 GAAAACTGACTAATACAGTTGGG - Intergenic
979983848 4:127291606-127291628 GAAAATGGACTAATATGCTTGGG - Intergenic
980199161 4:129632718-129632740 GAAAATGGACTAATATAGTCAGG - Intergenic
980212761 4:129811100-129811122 GAAAATGGACTAAAACACTCTGG + Intergenic
980294183 4:130888925-130888947 AAAAAAGGACTAATAGAGCCAGG - Intergenic
980553093 4:134365893-134365915 GAAAATGGCCTAATACAACCAGG + Intergenic
981422564 4:144567825-144567847 GAAAACAGACTAATGCACCTAGG + Intergenic
981556930 4:146005069-146005091 GTAAATGGACTAAGACAGAAGGG + Intergenic
981657419 4:147127663-147127685 AAAAATAGACTAATACAGTCAGG - Intergenic
981694791 4:147549418-147549440 GAAAACGGACTAATACATATGGG + Intergenic
981695398 4:147554025-147554047 GAAAATGGACTAATACAATTGGG + Intergenic
981997779 4:150993530-150993552 GAAAATGGACTAATACAATGAGG - Intronic
982320623 4:154073214-154073236 GAGAACAGACTAATACAGCATGG - Intergenic
982332536 4:154197065-154197087 AAAAATGGACTAATACAGAAAGG + Intergenic
982392753 4:154883876-154883898 GAAAATGGTCTAATATACCATGG - Intergenic
982430096 4:155313219-155313241 CCAAATGGACTAAGACAGCATGG - Intergenic
982797253 4:159661257-159661279 GAAAATGGACTAATACAGGCAGG - Intergenic
982829390 4:160042175-160042197 GAAAATGAACTAATACACCAGGG - Intergenic
982995770 4:162342969-162342991 GAGAACAGACTAATACAGGTGGG - Intergenic
983482527 4:168292338-168292360 AAAAATGTAATAATTCAGCTGGG - Intronic
983507894 4:168575200-168575222 GAAAACGGACTAATCCAAGTGGG - Intronic
983578870 4:169287993-169288015 GAAAACAGACTAATACAGGGGGG - Intergenic
983699722 4:170577646-170577668 GAAAATGGACTAATAATTTTAGG - Intergenic
983766507 4:171490539-171490561 GAGAATGGACTAATACAGTGTGG + Intergenic
983771895 4:171561229-171561251 GAAAATGAACTAAGACAGGGAGG - Intergenic
983772537 4:171569721-171569743 GAAAATGGACTAATACACTTGGG - Intergenic
983811303 4:172065662-172065684 GAGAATGGACTAACACAGTTAGG - Intronic
984106597 4:175555590-175555612 GAGAATGGACTAACACAGTGGGG + Intergenic
984150623 4:176125731-176125753 CAAAATGGACTAAGACAGTGAGG - Intronic
984718937 4:182952478-182952500 GAGAATGCACTAATACAACTAGG + Intergenic
984946362 4:184971718-184971740 GAAAACAGACTAATACACCATGG + Intergenic
985076952 4:186225171-186225193 GAAACTGGACTAATACATCTGGG + Intronic
985340203 4:188943049-188943071 GAGAATGGACTAATACAGAAAGG + Intergenic
985394505 4:189527753-189527775 GAGAATGAACTAATACAGTGGGG - Intergenic
986023906 5:3831770-3831792 GAGAATGGACTAATACAGTAAGG + Intergenic
986060619 5:4186939-4186961 GAAAATGGACAAATACACCATGG - Intergenic
986080961 5:4394026-4394048 GAAAACAGACTAATACAAGTGGG - Intergenic
986085053 5:4436794-4436816 GAAAATGGACTAATACAAAAGGG - Intergenic
986173006 5:5328775-5328797 GAAAACGGACGAATACACCCTGG - Intergenic
986221974 5:5776267-5776289 GGAAATGGACTAATACAGCCTGG + Intergenic
986406188 5:7427264-7427286 GAGAATGAACTAATACAGGTGGG - Intronic
986503584 5:8427256-8427278 GAAAATGGATGAATACACCCAGG - Intergenic
986552932 5:8978837-8978859 GAGAATGGACTAATACAAACAGG + Intergenic
986654806 5:10000335-10000357 GTAAATGGACTAATACACTGGGG - Intergenic
986751272 5:10790061-10790083 GAACCCGGACTAATACAGCTTGG - Intergenic
986798265 5:11233146-11233168 GAGAATGGACTAATACAGAGGGG + Intronic
986878943 5:12146742-12146764 GAGAACAGACTAATACAGCCAGG - Intergenic
987109542 5:14672419-14672441 GTATATGGCCTAGTACAGCTGGG - Intronic
987261907 5:16212888-16212910 GAAAATGGACTAATACAGAGTGG - Intergenic
987441650 5:17964414-17964436 GAAAACAGACTAATACAGTTTGG - Intergenic
987532459 5:19140356-19140378 GAGAATGGACTCATACAAATAGG - Intergenic
987909261 5:24121298-24121320 GAAAATGGACGAATACACAGAGG - Intronic
988137959 5:27199947-27199969 GAAAACAGACTAATACACTTGGG - Intergenic
988159500 5:27501946-27501968 GAAAATGGACTAATACAGTTGGG - Intergenic
988274839 5:29068188-29068210 GAGAATGGACTAATACACTAGGG - Intergenic
988289417 5:29266648-29266670 GAGAATGGACTAATACAGATAGG - Intergenic
988455955 5:31387529-31387551 AAGAATGGACTAATACAGGGTGG - Intergenic
988593225 5:32567406-32567428 GAGAATGGACTAATACAGGGTGG + Intronic
988644315 5:33077510-33077532 GAAAACGAACTAATACAGTTAGG + Intergenic
988701460 5:33679275-33679297 GAAAATGGACTAATACAGGAAGG - Intronic
988799168 5:34680213-34680235 GAAAATGGACTAAGACAGTAGGG - Intronic
988821241 5:34888199-34888221 CGAAATGGACTAAGACAGCATGG + Intronic
988924720 5:35978320-35978342 GAAAATGGACTAATACAGAGTGG - Intronic
989005039 5:36800792-36800814 GCAAATGGACTAACACACATGGG + Intergenic
989163816 5:38415676-38415698 GAGAACGGACTAATACAAATGGG - Intronic
989177385 5:38541843-38541865 GAAAATGAACAAATACAGATGGG + Intronic
989289505 5:39747012-39747034 GGGAATGGACTAATACAGCATGG + Intergenic
989562711 5:42870427-42870449 GAAAAACGATTACTACAGCTTGG - Intronic
989651453 5:43695648-43695670 GAAAATGGACTAATACACCTTGG - Intronic
989751331 5:44897230-44897252 GAAAATAGACTAATACAAAATGG + Intergenic
989752605 5:44913833-44913855 GAAAACAGACTAATACATCTGGG - Intergenic
989827780 5:45879746-45879768 GAAAACGAACTAATACAGTCTGG + Intergenic
990229420 5:53695566-53695588 AAAAATGGACTAATACAAATAGG + Intergenic
990304370 5:54480331-54480353 GAAAACAGACTAATACAACAGGG + Intergenic
990336652 5:54779227-54779249 GAAAATGAACTAATACAGAGGGG + Intergenic
990393059 5:55347679-55347701 CAAAATGGACTAAGACAGCCAGG - Intronic
990480364 5:56204713-56204735 GAGAATGGACTAATACAGGTAGG + Intronic
990558810 5:56963531-56963553 GAAAATTGACTAATACAGTCTGG + Intronic
990891591 5:60656520-60656542 GAAAACAGACTAATACAGTGGGG - Intronic
991158506 5:63467000-63467022 GAAAACGGACTAATACATCAGGG + Intergenic
991195297 5:63924979-63925001 GAAAATGGACTAATACATGTGGG + Intergenic
991259590 5:64652638-64652660 GAAAATGGACTAATACAGAGGGG - Intergenic
991429631 5:66530770-66530792 GAGAATAGACTAATATAGCAAGG - Intergenic
991605979 5:68401600-68401622 GAGAATGGACTAATACAGTTTGG - Intergenic
991665160 5:68992431-68992453 GAGAATCAACTTATACAGCTAGG + Intergenic
992075906 5:73192486-73192508 GAGAATGGACTAATACACTTGGG + Intergenic
992218993 5:74553533-74553555 GAGAATAGACTAATACAGAGGGG - Intergenic
992270524 5:75058405-75058427 GAGAATGGACTAAGATAGCTTGG + Intergenic
992313566 5:75529052-75529074 GCAAATGGACTAACACAATTAGG - Intronic
992924609 5:81568508-81568530 GAAAACGGACTAATATAGTTTGG + Intronic
992938886 5:81742053-81742075 GGAAATTGACTTATGCAGCTAGG - Intronic
993520902 5:88898826-88898848 AAGAATGGATAAATACAGCTGGG - Intronic
993569844 5:89523884-89523906 GAAAATGGACTAATACAAAGGGG - Intergenic
993704513 5:91154592-91154614 GAGAATGGACTAATACAGATAGG - Intronic
993884160 5:93396852-93396874 GAGAATGGACTAATACAGAAGGG + Intergenic
994081973 5:95717032-95717054 GAGAACAGACTAATACAGCTGGG + Intronic
994186655 5:96822703-96822725 GAAAAGGAACTAATACAAATGGG - Intronic
994187442 5:96830997-96831019 GAGAAGGAACTAATACAGCCAGG - Intronic
994578472 5:101610540-101610562 GAGAATGGACTAATACACGTGGG - Intergenic
994614089 5:102081590-102081612 GAAAACAGACTAATACAGGTTGG - Intergenic
994866364 5:105276867-105276889 GAAAATGGACTAATACATACTGG + Intergenic
994919929 5:106031014-106031036 GAAAACAGACTAATACACCCAGG - Intergenic
994920360 5:106034976-106034998 GAGAATGGACTAATACAGAGGGG - Intergenic
995062621 5:107827848-107827870 GAAAATGGACTTATTGATCTTGG + Intergenic
995244338 5:109919533-109919555 GAAAATGGACTAATACACCCTGG + Intergenic
995304593 5:110630747-110630769 GAGAATGAACTAATACAGAAGGG + Intronic
995318165 5:110800139-110800161 GAAAATGGACTAATACAGAGAGG - Intergenic
995598182 5:113768907-113768929 GAAAATGAACTAATATAGGTAGG + Intergenic
995690677 5:114823241-114823263 AAAAACTGACTAACACAGCTGGG - Intergenic
996010252 5:118474454-118474476 GAGAACAGACTAATACAACTGGG - Intergenic
996333134 5:122353826-122353848 GAAAATGGACTAATACGGCAGGG + Intronic
996515895 5:124368976-124368998 GAAAATGGACTAAAACAGTTGGG - Intergenic
996646011 5:125817693-125817715 GCAAATGGACTAACACAGGTGGG + Intergenic
996768160 5:127056308-127056330 GAAAACGGACTAATTCATCATGG - Intronic
996774590 5:127120108-127120130 GAGAACAGACTAATACACCTTGG - Intergenic
996908435 5:128629670-128629692 GAGAATGAACTAATACAGAGGGG - Intronic
997065471 5:130554382-130554404 GAGAATGGACTAATGCACCAAGG - Intergenic
997269532 5:132525246-132525268 GAGAATGAACTAATACACATGGG + Intergenic
997652151 5:135530417-135530439 GAAAACTGACTAATACAGATGGG - Intergenic
998144983 5:139722345-139722367 GAAAATGGACTAATACAATGGGG + Intergenic
998588550 5:143453676-143453698 GAGAATGGACTAATACAAGGAGG - Intergenic
998687716 5:144548750-144548772 GAGAATGGACTAATACAGCATGG + Intergenic
998700821 5:144697675-144697697 TAAAATGGACTAAAACAGACAGG + Intergenic
998850638 5:146347363-146347385 AAAAATGGAATAATACAGAAGGG + Intergenic
998924519 5:147107106-147107128 CAAAACGGACTAAGACAACTTGG + Intergenic
999425674 5:151486005-151486027 GCAAATGGACTAACACACCAGGG - Intronic
999504249 5:152179048-152179070 GAAAACTGACTAATACAAGTGGG - Intergenic
1000222437 5:159226969-159226991 GGAAATGAACTAATACAGGGAGG - Intergenic
1000238944 5:159391079-159391101 GAAAATGGGCTAATACAAGTAGG - Intergenic
1000418184 5:161006092-161006114 AAGAATGGACTAATACAGTTGGG + Intergenic
1000876683 5:166647949-166647971 CTAAATGAACCAATACAGCTAGG + Intergenic
1001490674 5:172152606-172152628 GAGAATGGAATAATACATTTAGG - Intronic
1001500113 5:172224806-172224828 GAAAACAGACTAATACAGAGAGG + Intronic
1001627579 5:173149181-173149203 GAAAACAGACTAATACAGATGGG - Intronic
1001947402 5:175791314-175791336 CAAAATGGACTAAAACATGTGGG + Intergenic
1002565122 5:180108494-180108516 GAAAATAGACTGAAACGGCTGGG - Intronic
1003180320 6:3785272-3785294 GAGAATGGACTAATACACTTGGG + Intergenic
1003279435 6:4678919-4678941 GAAACTGGATTAATACAACCAGG + Intergenic
1003280029 6:4683164-4683186 GACAAAGGACTAATACAGTGAGG + Intergenic
1003665434 6:8107277-8107299 GAAAATGGACTAATACATGGTGG - Intergenic
1003818327 6:9866507-9866529 GAAAATGGACTAATACAAATGGG + Intronic
1003857303 6:10289639-10289661 GAAAACAGACTAATACAGGCAGG - Intergenic
1003897825 6:10624203-10624225 GAAAACGGACTAATACACCTTGG - Intronic
1003946474 6:11080646-11080668 GAGAATGGACTAATACACTCTGG - Intergenic
1004858389 6:19775372-19775394 GAAAACAGACTAATACAGTATGG - Intergenic
1005362733 6:25046990-25047012 GAGAACTGACAAATACAGCTAGG - Intergenic
1005802794 6:29444370-29444392 GAAAACAGACTAATACACCTTGG + Intronic
1005982830 6:30850565-30850587 GAAAACGGACTAATACGGCTGGG + Intergenic
1006421682 6:33938426-33938448 GAAAATGGACTAATCCAGCTGGG - Intergenic
1006916960 6:37600944-37600966 GAAAATGGACTTATACAATGGGG - Intergenic
1007460144 6:42012017-42012039 AAAAATGAGCTAATGCAGCTGGG - Intronic
1008025775 6:46634392-46634414 GAAAACGGACTAATACAAATAGG + Intronic
1008048866 6:46879644-46879666 AAAAATGGACTAATACATATCGG + Intronic
1009327630 6:62373638-62373660 GAAAACGGACTAATACAAGTTGG - Intergenic
1009461001 6:63912960-63912982 AAGAATGGACTAATACAGTGAGG + Intronic
1009496222 6:64351121-64351143 GAGAATGGATTAATACATCCAGG + Intronic
1009614909 6:65991389-65991411 GAGAATGTACTAATACAACTAGG - Intergenic
1009655038 6:66533058-66533080 GAGAATGGACTAATACAATAGGG - Intergenic
1009710100 6:67307390-67307412 GAGAATCAACTAATACAGTTAGG + Intergenic
1009776264 6:68209537-68209559 AAGAATGGACTAATATAGTTTGG + Intergenic
1009825207 6:68858135-68858157 GAAAATGGACTAATACAGTCAGG + Intronic
1009956653 6:70463237-70463259 GAAAAAGGACTATGACAGCAAGG - Intronic
1010132111 6:72506665-72506687 GAGAATGGACTAATAGAGTTGGG - Intergenic
1010330557 6:74618677-74618699 GAAAACGAACTAGTACACCTGGG - Intergenic
1010552871 6:77244539-77244561 GAGAATGGACTAACACAGAATGG - Intergenic
1010810255 6:80292237-80292259 GAGAATAGACTAATACACCAAGG - Intronic
1010879728 6:81152929-81152951 GAAAATGGACTAATTCAAGGAGG - Intergenic
1011000103 6:82578804-82578826 GAAAATGAACTAGCACAGCATGG + Intergenic
1011032087 6:82934321-82934343 GAGAATGGACTAATACAATGAGG + Intronic
1011236794 6:85227401-85227423 GAAAATGGACTACTACAGTTAGG - Intergenic
1011346448 6:86374428-86374450 GACAATGGACTAACACAGTGGGG - Intergenic
1011890056 6:92147039-92147061 GAAAACGGACTAATACACGGTGG + Intergenic
1012107571 6:95183165-95183187 GAAAACAGACTAATACAACATGG + Intergenic
1012147502 6:95703930-95703952 GAAAACGAACTAATACAGAGTGG - Intergenic
1012188771 6:96255010-96255032 GAAAATGGACTAATACAATTAGG - Intergenic
1012213599 6:96555890-96555912 GAAAACGGACTAATACACTCTGG - Intergenic
1012226243 6:96705963-96705985 GAGAACGGACTAATACACCGTGG + Intergenic
1012277976 6:97296703-97296725 GAGAATAGACTAGTACAACTAGG - Intergenic
1012638837 6:101582597-101582619 GAGAATGGACTAATACAGATGGG + Intronic
1012865239 6:104610971-104610993 GAGAATGGACTAATACACCCAGG - Intergenic
1013084936 6:106848348-106848370 GAGAATAGACTAATACAACTGGG + Intergenic
1013086753 6:106863869-106863891 GAAAACAGACTAATACAACTGGG + Intergenic
1013121199 6:107142860-107142882 GAAAATGGTAAAATACAGCCAGG + Intergenic
1013213376 6:108006066-108006088 GAGAATGGACTAATATATATGGG - Intergenic
1013378806 6:109545684-109545706 GAAAATGGACTAATACACCAAGG + Intronic
1013419384 6:109952087-109952109 AAGAACGGACTAATACAGCCAGG + Intergenic
1013486776 6:110604247-110604269 AAAAATGGACTAATGCAGAAAGG + Intergenic
1013859022 6:114610938-114610960 GAGAATGGACTAATAGAGTTAGG + Intergenic
1013862233 6:114649722-114649744 AAAAATGGACTAAGACACCCAGG + Intergenic
1014147530 6:118015237-118015259 GAAGATGGACTAATACACTTAGG + Intronic
1014326729 6:120005883-120005905 GAGAATGGACTGATACAATTAGG + Intergenic
1014402360 6:121006343-121006365 GAGAATGGACTAATACAGTAAGG + Intergenic
1014701958 6:124699824-124699846 AAAAACGGACTAATACACCTTGG + Intronic
1014851606 6:126346642-126346664 GAAAATGGACTAATACAATGAGG - Intronic
1014918532 6:127183814-127183836 GAGAATGCACTAATACAGGTGGG - Intronic
1015252737 6:131143604-131143626 GCGAATGGACTAATACAACAGGG + Intronic
1015436572 6:133196438-133196460 AAAAATGGACTAATTCATCATGG - Intergenic
1015490797 6:133823429-133823451 GAAAATGGACTAATATACTGAGG - Intergenic
1015748208 6:136533537-136533559 CAAAACGGACTAACACAGATGGG - Intronic
1015907829 6:138135953-138135975 CAAAATGGACCAATACAGAATGG + Intergenic
1015983007 6:138857808-138857830 GAGAATGGAATAATACACATAGG - Intronic
1016094475 6:140019397-140019419 GAGAATGGACTAATACAAGAAGG - Intergenic
1016124998 6:140389244-140389266 GAAAACAGACTAATACAGTGTGG - Intergenic
1016148524 6:140706353-140706375 GAAAATGGACTAATATGGCTGGG + Intergenic
1016237551 6:141886871-141886893 GAGAATGGACTAATACAGCATGG - Intergenic
1016241732 6:141939368-141939390 TAAAGGGGACTAATACAGTTTGG + Intergenic
1017524353 6:155229694-155229716 GAAAATGAATTAATACACCTGGG - Intronic
1017631850 6:156403624-156403646 GAGAACGGACTAATACAGATGGG + Intergenic
1017651457 6:156586889-156586911 GAAAATGGATTCATAGATCTTGG + Intergenic
1017763474 6:157588974-157588996 GAAAATAGACTAATACAGATGGG - Intronic
1017794991 6:157835875-157835897 GAAAACAGACTAATACAGTCTGG + Intronic
1018071455 6:160167804-160167826 GAGAATGAATGAATACAGCTGGG + Intergenic
1018182389 6:161235510-161235532 GAGAATGGACTAATCCAGATGGG - Intronic
1018440994 6:163813254-163813276 AAAAATGGACTAATACAGTCAGG + Intergenic
1018473886 6:164121764-164121786 AAAAATGGACTAATACAGCTGGG - Intergenic
1018554732 6:165037499-165037521 GAAAACGGACTAATATAGCAGGG + Intergenic
1018585706 6:165355870-165355892 GAAAATGGACTAATACAGCAAGG - Intronic
1018614399 6:165672808-165672830 GAAAACGGACTAACACAGATGGG + Intronic
1019022304 6:168929576-168929598 GAAAACACACTAATACAGGTAGG + Intergenic
1019150703 6:170003739-170003761 GAGAATGGACTAATACAGCAAGG - Intergenic
1019896767 7:3989102-3989124 GAAAACCGACTAATACAGATAGG - Intronic
1019981109 7:4622917-4622939 GAGAATGGACTAATATAGGGAGG + Intergenic
1020345234 7:7154989-7155011 GAAAATGGACTAATACACATGGG + Intergenic
1020389875 7:7646653-7646675 GAAAATGAACTAATACAGATGGG + Intronic
1020546809 7:9542567-9542589 GAGAATGGACTAATATATCTAGG + Intergenic
1020581937 7:10012845-10012867 GAGAATGGACTAATACAAGGGGG + Intergenic
1020706516 7:11550718-11550740 GAAAATGAACTAATTCAGATAGG + Intronic
1020774403 7:12435347-12435369 GAAAACAGACTAATACATATGGG - Intergenic
1021507731 7:21403849-21403871 CAAAATGGACTAATACCGTAGGG + Intergenic
1021665592 7:22975069-22975091 GAAAATGGACTAATACACTCAGG + Intronic
1022044514 7:26612343-26612365 AAAAATGGCCTAACACACCTGGG + Intergenic
1022549882 7:31228438-31228460 GAAAACAAACTAATACAGTTGGG + Intergenic
1022592076 7:31673133-31673155 GAAAATGGACTAATACAGTGGGG + Intergenic
1022982627 7:35618682-35618704 GAAAATGGACTAATACAGAGTGG + Intergenic
1023265124 7:38396506-38396528 GAAAATGGACTAATACAATATGG + Intronic
1023932428 7:44713946-44713968 GGGAATGGACAAAGACAGCTTGG - Intergenic
1024115003 7:46184517-46184539 ATAAATGGAATCATACAGCTTGG - Intergenic
1024378145 7:48662642-48662664 GAAAACAGACTAATACAATTGGG + Intergenic
1024383377 7:48724369-48724391 GAAAATAGACTAATACAGCCAGG - Intergenic
1024684770 7:51733544-51733566 GAAAATGGATTAATACACCAGGG - Intergenic
1024754819 7:52517679-52517701 AAGAATGGACTAATACAGCAAGG - Intergenic
1025223158 7:57133453-57133475 GAAAATGGACTAATACATGCGGG + Intronic
1025719557 7:63997791-63997813 GAAAATGGACTAATACATTCAGG - Intergenic
1025742083 7:64206029-64206051 GAAAATGGACTAATACATGCAGG - Intronic
1025746539 7:64247963-64247985 GAAAATGGACTAATACATGCAGG - Intronic
1026295107 7:69044775-69044797 GAAAATGGACTAATACACCTGGG - Intergenic
1026454873 7:70562221-70562243 CAAAATGGACAAATACACATGGG + Intronic
1026619412 7:71937061-71937083 GAAAATGGACTAATACAATTAGG + Intronic
1026655986 7:72256957-72256979 GAAAATGAACTAATACAGTGGGG - Intronic
1026703831 7:72672311-72672333 GAAAATGGACTAATACCCAAGGG + Intronic
1026800098 7:73394855-73394877 GAAAACAGACTAATACAGAATGG + Intergenic
1027392573 7:77720057-77720079 AAAAAAGGACACATACAGCTGGG - Intronic
1027419480 7:78005557-78005579 GAAAACGGACTAATACACTCAGG + Intergenic
1027513915 7:79116989-79117011 AAAAATGGGCTAATACACCCAGG + Intronic
1027584645 7:80043683-80043705 GAGAACGGACTAATACAACATGG - Intergenic
1027648768 7:80838566-80838588 GAAAATGGACTAATATAGTAGGG - Intronic
1027732575 7:81894547-81894569 GAAAATGGAATAATAGACATTGG - Intergenic
1027785390 7:82573702-82573724 GAGAAAGGACTAATATAGGTAGG - Intergenic
1027937996 7:84633395-84633417 GAAAACGAACTAATACAGTTGGG + Intergenic
1028011218 7:85647725-85647747 GAAAATGAAATAATACAGTGAGG - Intergenic
1028264272 7:88703829-88703851 AAAAATGGACAAATACGGCCAGG - Intergenic
1028393235 7:90338540-90338562 GAGAATGGACTAATACAGGAAGG + Intronic
1028831876 7:95337422-95337444 GAGAATGGACTAATACAGCTGGG - Intergenic
1028877870 7:95843910-95843932 GAGAAAGAACTAATATAGCTTGG + Intronic
1028884288 7:95913687-95913709 GAGAAAGGACTAATACACATGGG + Intronic
1028930185 7:96404349-96404371 TATAATGGACTAATACACATGGG + Intergenic
1029162869 7:98565021-98565043 GCAAATGGACTAACACATCCTGG + Intergenic
1029210400 7:98903680-98903702 GAAAACAGACTAATACAGGGAGG - Intronic
1029303211 7:99600425-99600447 GAGAACAGACTAATACACCTGGG - Intronic
1029441988 7:100591932-100591954 GAAAATGGACTAATACAGGTGGG - Intronic
1029462159 7:100701529-100701551 GAAAATGGGCAAATCCAGCCTGG - Intergenic
1029591294 7:101508805-101508827 CAAAACGAACTAATACAGGTGGG - Intronic
1029592618 7:101517312-101517334 GAAAACGGACCAATACAGATGGG - Intronic
1029814309 7:103077321-103077343 GAAAATGGACTAATACAGTAAGG - Intronic
1029909791 7:104133547-104133569 GGAAATGTATTAATATAGCTGGG + Intronic
1030249834 7:107429936-107429958 GAAAACGGACTAATACAGTTGGG + Intronic
1030532567 7:110729176-110729198 AAAAACAGACTAATACGGCTGGG - Intronic
1030554534 7:111006995-111007017 GAAAACTGACTAATACAAGTAGG - Intronic
1030756015 7:113288918-113288940 GAAAATGGTCTAATATACTTTGG + Intergenic
1030787016 7:113674828-113674850 GAAAATGGACTAATACACAGGGG - Intergenic
1030803630 7:113886547-113886569 GAAAATAGACTAATACAGGTGGG + Intronic
1030819587 7:114079776-114079798 GAACAAGGACTAATGCTGCTTGG + Intergenic
1030956211 7:115855847-115855869 GAAAATGGACTAATACACCCAGG - Intergenic
1031113987 7:117647263-117647285 AAGGATGGACTAATACAGCTGGG - Intronic
1031175908 7:118350073-118350095 GAAAATTGACTAATACAATATGG - Intergenic
1031432051 7:121683991-121684013 GAAAATAGACTAATACAGAAGGG - Intergenic
1031480049 7:122267371-122267393 GAAAATGAACTAATACAGATGGG + Intergenic
1031549736 7:123093644-123093666 CAAAATGGACTAAGACAGTGGGG + Intergenic
1031623248 7:123961699-123961721 GAAAATGGACTAATACACATAGG - Intronic
1031785378 7:126024351-126024373 GAAAATGGACTAATACAGGCTGG + Intergenic
1031790449 7:126095068-126095090 GAAAATGGACTAACAGAGTGGGG - Intergenic
1032341297 7:131075700-131075722 GAAAATGGACTAAAACAGAGAGG - Intergenic
1032582169 7:133113479-133113501 GAGAACAGACTAATACAGCGAGG - Intergenic
1032674413 7:134115359-134115381 GAGAATGGATTAATACAGTGAGG + Intergenic
1033257678 7:139816283-139816305 GAAAATCGGCTAATACAGATGGG + Intronic
1033304941 7:140218445-140218467 GAAAATGGACTAATACCGAAGGG + Intergenic
1033433117 7:141307283-141307305 GAAAATGGATTAATTTAGCAAGG + Intronic
1033487635 7:141806403-141806425 GAGAATGGACTAATACAGAGGGG + Intergenic
1033716933 7:144011779-144011801 AAAAACAGACTAATACAGCAGGG + Intergenic
1033730394 7:144172303-144172325 GAAAGTGAACTAATACGGCATGG + Intergenic
1034083610 7:148303124-148303146 GAAAATGGACTAATACACCATGG + Intronic
1034204186 7:149301426-149301448 AAAAATGGACTAATACACCATGG + Intergenic
1034364798 7:150536740-150536762 AAGAATGGCCTAACACAGCTTGG - Intergenic
1034683745 7:152951486-152951508 GAGAATGGACTAATACACATGGG + Intergenic
1034717829 7:153260054-153260076 GAAAATGGACTAGGACAACAGGG - Intergenic
1034761002 7:153671752-153671774 GAAAACCGACTAATACGGGTGGG + Intergenic
1034943273 7:155245694-155245716 GAGAATGGACTAATACATCAAGG - Intergenic
1035106677 7:156446830-156446852 GAAAATGGACCAAGACAGGTGGG - Intergenic
1035371159 7:158379756-158379778 GAAAAAGGACTAATACAGCTAGG - Intronic
1035405673 7:158595564-158595586 GAGAACGAACTAATACAGGTAGG - Intergenic
1035840625 8:2809122-2809144 GAAAATGGATGAATACAGACAGG - Intergenic
1036087375 8:5626895-5626917 GAAAATGGACTAATACAGAGGGG + Intergenic
1036623445 8:10444610-10444632 GAGAATGGACTAATACAAACAGG + Intergenic
1036726126 8:11222874-11222896 GAGAATGGACTAATACAGAGAGG - Intergenic
1037107854 8:15131490-15131512 GAAAATGGACTAATACACTAAGG + Intronic
1037142224 8:15533279-15533301 GAAAATTGATTAATACAGAGGGG + Intronic
1037331288 8:17746348-17746370 GAAAATGGACTAATACGTAGAGG - Intronic
1037345113 8:17890604-17890626 GAGAATGGACTAAGACAGTAGGG - Intronic
1037622611 8:20578050-20578072 GAGAACGGACTAATACAGTAAGG + Intergenic
1038139691 8:24830833-24830855 GAAAACGGACTAATGCTGCTGGG - Intergenic
1038150012 8:24934540-24934562 AAGAATGGCCTAATACAGATAGG + Intergenic
1038167615 8:25101014-25101036 GAAAATGAACTAATATACCAGGG - Intergenic
1038217335 8:25574350-25574372 GAGAATGGACTAATACACTGAGG + Intergenic
1038281929 8:26173528-26173550 AAAAATGGACTAGTATAGCTGGG + Intergenic
1038522461 8:28244911-28244933 GAAAATAGACTAATACAGATGGG - Intergenic
1038549794 8:28457375-28457397 GAAAATGGACAAATACACAAGGG - Intronic
1038646108 8:29363747-29363769 CAAAATGGACTAAGACATGTAGG - Intergenic
1039072530 8:33659850-33659872 GAAAATGAACTAATACATGTGGG + Intergenic
1039211371 8:35218774-35218796 GAAAACAGACTAAGACAGATGGG + Intergenic
1039828861 8:41197075-41197097 GAAAAAGGTCTTATACAGCCAGG - Intergenic
1039858693 8:41437995-41438017 GAAAACGGAGTAATACACCATGG + Intergenic
1040577578 8:48667255-48667277 GAAAATGAACTAATACAGCCAGG - Intergenic
1040678436 8:49780495-49780517 CAAAATGGACTAAGACATTTAGG - Intergenic
1040805062 8:51385986-51386008 GAAAATGGACTAATAGACCATGG + Intronic
1041288073 8:56281347-56281369 GAGAATGGACCAATACACCATGG - Intergenic
1041346552 8:56904763-56904785 CAAAATGAACTTATACCGCTAGG + Intergenic
1041739444 8:61142429-61142451 GAAAATGGACTAATACAATTGGG + Intronic
1042085249 8:65100228-65100250 GTAAATGGACTAATACCCCAAGG + Intergenic
1042501832 8:69516988-69517010 GAAAATGGACTAAGACAGCAGGG - Intronic
1042520300 8:69704439-69704461 AAAAATGGAACAATATAGCTTGG - Intronic
1042613245 8:70620817-70620839 GACAAAGGACTAATTCAGCTTGG + Intronic
1042631352 8:70820527-70820549 GAAAATGAACTAATACAAGCTGG - Intergenic
1042685188 8:71430933-71430955 GAACATGGAACAAGACAGCTTGG + Intronic
1042923351 8:73941298-73941320 GAAAATGGACTAATACAGAGAGG + Intronic
1043050596 8:75380633-75380655 GAAAATGGACTAATGCCGCATGG + Intergenic
1043067003 8:75586115-75586137 GAAAATGGTCTGAGACAGTTGGG + Intergenic
1043360112 8:79462007-79462029 GACAATGGACTAATAGAGATGGG + Intergenic
1043419410 8:80083725-80083747 GAGAATGGACTAGTACACCTTGG + Intronic
1043941915 8:86205576-86205598 GCAAATTGACTAATACAGGAAGG + Intergenic
1044094051 8:88040580-88040602 GGCAATGGCCTAATACAACTTGG + Exonic
1044122408 8:88413855-88413877 GAAAATAGGCTAATAGAGCGGGG + Intergenic
1044529506 8:93291361-93291383 GAAAATGGACTAACACACCCGGG - Intergenic
1044541501 8:93413508-93413530 GAAAACGGACTAATACAGCAGGG - Intergenic
1044610967 8:94091796-94091818 GAAAACAGACTAATAGAGTTAGG + Intergenic
1044942452 8:97357102-97357124 GAAAACAGACTAATACATGTAGG - Intergenic
1046165760 8:110432614-110432636 GAAAATGGACTAATACAGACTGG + Intergenic
1046272595 8:111915989-111916011 GAAAATGAACTAAGACAGGAAGG - Intergenic
1046276701 8:111971025-111971047 GAAAACAGACTACTACAGATGGG - Intergenic
1046367903 8:113260187-113260209 GAGAATGGACCAATACAGGCAGG + Intronic
1046617126 8:116489979-116490001 GAAAATGGACTAATATAGGGTGG - Intergenic
1046776383 8:118168204-118168226 GAAAATAGACTAATACACAATGG + Intergenic
1047195703 8:122719358-122719380 GAAAATGGACTAATACAGTGGGG + Intergenic
1047374242 8:124281145-124281167 GAGAATGGACTAATACAGGTGGG - Intergenic
1047519136 8:125580947-125580969 AAAAATGGACAAATACACCTTGG - Intergenic
1047714616 8:127584186-127584208 GAGAATGGAATAATACATCGGGG - Intergenic
1047938718 8:129807002-129807024 TAAAATGGACTAATACAGGAAGG + Intergenic
1047984688 8:130220662-130220684 GAGAACGGACTAATACAGTGGGG - Intronic
1048026075 8:130588133-130588155 GAAAACGGACTAATATACCATGG - Intergenic
1048115258 8:131514433-131514455 AAGAATGGGCTAATACAGATGGG + Intergenic
1048128583 8:131665563-131665585 GAGAATGGACTAATACAGATTGG - Intergenic
1048478698 8:134768413-134768435 GAAAATGGACTAATACAGAGAGG - Intergenic
1048499449 8:134962344-134962366 GAACACTGACTAATACACCTGGG + Intergenic
1048622888 8:136153892-136153914 GAGAATGGACTAATACACCATGG + Intergenic
1049489461 8:142887200-142887222 GACAATGAACTAATACAAATTGG - Intronic
1049946802 9:604946-604968 GAAAATGGACTAATGCAATTGGG + Intronic
1050104242 9:2149047-2149069 GAAAACAGACTAATACAGGCAGG - Intronic
1050280730 9:4047362-4047384 GAAAACGGACTAATACAATTGGG + Intronic
1050564933 9:6872247-6872269 GAAATTGGAGTGATACTGCTGGG + Intronic
1050769323 9:9177005-9177027 GAAAATGAATTAATACAAGTGGG - Intronic
1050821834 9:9888788-9888810 ACAAATGGACTAAGACAGATAGG + Intronic
1051217066 9:14809325-14809347 CAAAATGGACTAATACAGGGAGG + Intronic
1051242555 9:15075252-15075274 GAGAACGGACTAATACAGGATGG - Intergenic
1051279669 9:15429390-15429412 GCAAAAGGACTAATACAGAGAGG + Intronic
1051339172 9:16095168-16095190 GAGAAGGGACTAATATAGCATGG + Intergenic
1051890655 9:21939278-21939300 GAAAACGGACTAATGCACATGGG + Intronic
1051975256 9:22941205-22941227 GAAAACAGACTAATACAACATGG - Intergenic
1051988312 9:23118754-23118776 GAAAATGGACTAATACAAGTAGG - Intergenic
1052078915 9:24179491-24179513 GAAAATGGACTAATACAGGCAGG - Intergenic
1052195962 9:25715277-25715299 GAAATTAGACCAAGACAGCTAGG - Intergenic
1052267517 9:26591359-26591381 GAAAATGAACTAACACAGGAGGG - Intergenic
1052636771 9:31116561-31116583 GAAAATGTACAAATACATCATGG - Intergenic
1052667343 9:31512085-31512107 GGAAACAGACTAATACAGTTGGG + Intergenic
1052688523 9:31783952-31783974 GAAAATGGACTAATACACTGAGG - Intergenic
1052701492 9:31942505-31942527 GAAAATGGACTAATACACTTGGG + Intergenic
1052879958 9:33595685-33595707 GAAAATGCACAGATGCAGCTTGG + Intergenic
1053496015 9:38548535-38548557 GAAAATGCACAGATGCAGCTTGG - Intronic
1053519619 9:38764536-38764558 GTAAATGGACTAATACACAGTGG + Intergenic
1053675534 9:40421741-40421763 GAAAACAGACTAATACAGCTAGG + Intergenic
1053925328 9:43048079-43048101 GAAAACAGACTAATACAGCTAGG + Intergenic
1054288810 9:63260267-63260289 GAAAACAGACTAATACAGCTAGG + Intergenic
1054386632 9:64561804-64561826 GAAAACAGACTAATACAGCTAGG + Intergenic
1054453775 9:65419062-65419084 GAGAACGGACTAATACACCATGG + Intergenic
1054509088 9:65954551-65954573 GAAAACAGACTAATACAGCTAGG - Intergenic
1055330921 9:75183291-75183313 GAAAACGGACTAATGCATCTTGG - Intergenic
1055366933 9:75554804-75554826 GAAAATGAACTAATACATATGGG - Intergenic
1056227040 9:84505894-84505916 AAGAATGGACTAATACAAGTGGG - Intergenic
1056473708 9:86931441-86931463 GAAAATGGACTAATATAAAGAGG + Intergenic
1056527108 9:87453947-87453969 GAAAATGTACTAATACAGAGGGG - Intergenic
1056586124 9:87928346-87928368 GAAAATGCACAGATGCAGCTTGG - Intergenic
1056610758 9:88124597-88124619 GAAAATGCACAGATGCAGCTTGG + Intergenic
1056733362 9:89184311-89184333 GAGAATGGACTAATACAGTGAGG + Intergenic
1056962305 9:91136364-91136386 GAAAATGGACTAATACAAGTGGG - Intergenic
1057317983 9:93982977-93982999 GAAAATGAACTAATATATCTAGG + Intergenic
1057675944 9:97136053-97136075 GAAAATGCACAGATGCAGCTTGG - Intergenic
1057698954 9:97349086-97349108 GAAAAAGGATTAAGAGAGCTGGG - Intronic
1057794987 9:98149397-98149419 CAAAATGGACTAACACACCCAGG - Intronic
1057976898 9:99614789-99614811 AAGAATGGACTAATACACCTAGG + Intergenic
1058083088 9:100719617-100719639 GAAAACGGACTAATACATTCAGG - Intergenic
1058086301 9:100752157-100752179 GAAAATGGACTAACACATCAAGG - Intergenic
1058086876 9:100757067-100757089 GAAAATGGACTAATACAAGGGGG + Intergenic
1058180090 9:101787078-101787100 TTAAATTGACTAATACAGGTAGG + Intergenic
1058736203 9:107896424-107896446 GAAAATGAACTAATACCCCTGGG + Intergenic
1058847085 9:108971743-108971765 GAGAACAGACTAATACAGTTGGG + Intronic
1058910394 9:109515522-109515544 CAAAATGGATTAACACAGTTGGG - Intergenic
1059363523 9:113767102-113767124 GAAAATGGACTAATACAGGCTGG + Intergenic
1059719502 9:116945815-116945837 GAAAACAGACTAATACAGGTGGG - Intronic
1059990480 9:119860625-119860647 GAGAATGAACTAATACAAGTAGG - Intergenic
1060019728 9:120118629-120118651 AAAAATGGACTAATACAGCTGGG + Intergenic
1060178186 9:121513229-121513251 GAAAATGGACTAATGCTAGTAGG - Intergenic
1060620443 9:125060835-125060857 GAAAATGGACTAATACAGCTAGG + Intronic
1061166380 9:128924964-128924986 GTAAATACACAAATACAGCTAGG - Intronic
1061341439 9:129984970-129984992 GAAAATGGACTAATACAATTAGG + Intronic
1061851074 9:133415991-133416013 CACAATGAACTAATACAGATGGG - Intronic
1062064511 9:134518971-134518993 GAGAATGGACTAATACACTGTGG + Intergenic
1185561604 X:1064211-1064233 GAACACAGACTAACACAGCTGGG + Intergenic
1185740474 X:2527919-2527941 GAAAATGGACTAATACGTGGAGG - Intergenic
1185786155 X:2892674-2892696 TTAAATTGACTAAGACAGCTGGG - Intergenic
1185974285 X:4701681-4701703 GAAAATGGACAAATACACTCTGG + Intergenic
1186051767 X:5604177-5604199 GAGAATGGACTAATACAGATGGG - Intergenic
1186168150 X:6848936-6848958 AAAAATGGCCTAACACAGTTGGG + Intergenic
1186233683 X:7484109-7484131 GAAAATGGACTGATACACTAAGG - Intergenic
1186558223 X:10583674-10583696 CAAAATGGACTAAAACATCATGG - Intronic
1187133431 X:16524971-16524993 GAAAATGGACTAATACACTTAGG - Intergenic
1187930499 X:24289452-24289474 GAGAAGGGACTAATACACTTGGG - Intergenic
1188473251 X:30563396-30563418 GAGAATGGACTAATACACATGGG + Intronic
1188736377 X:33721679-33721701 GAGAATGGACTAATACAGTAGGG - Intergenic
1188775764 X:34216364-34216386 GAAACTTGACTAATACACCAAGG + Intergenic
1188822253 X:34789783-34789805 GAGAATGGACTAATACAGTCAGG + Intergenic
1188828594 X:34868202-34868224 AAAAATGGACTAATACATCCTGG - Intergenic
1188872972 X:35397444-35397466 GAGAATGGACTAATACAAAGAGG - Intergenic
1188985292 X:36763549-36763571 GAAAACAGACTAATACAGTAGGG - Intergenic
1189371458 X:40432589-40432611 GAAAACGGACTAATATACCCTGG + Intergenic
1189403121 X:40690953-40690975 GAAAATGGACTTTTTCAGTTGGG - Intronic
1189433206 X:40968056-40968078 GAGAATGGACTAATACAGTAAGG - Intergenic
1190047764 X:47126439-47126461 GAAAATGGACTAATACAGGGAGG - Intergenic
1190080157 X:47350460-47350482 GAAAATGAACAAATAAGGCTGGG + Intergenic
1190469578 X:50764801-50764823 GAAAATGGACTAATACAAGTTGG - Intronic
1190578507 X:51867275-51867297 GAACCCTGACTAATACAGCTTGG - Intronic
1191749069 X:64521322-64521344 GAACATGGACTAATACAGTCTGG + Intergenic
1192565152 X:72157354-72157376 CAAAATGGACTAAGACACCCTGG - Intergenic
1192676420 X:73201842-73201864 GAAAATGGACTAATACACTATGG - Intergenic
1193003965 X:76595632-76595654 GAAAACGGACTAATACAGATGGG - Intergenic
1193271976 X:79538760-79538782 GAAAACAGACTAATACAGGGTGG + Intergenic
1193329807 X:80223389-80223411 AAAAATGGACTAATACAGTTAGG + Intergenic
1193482645 X:82046423-82046445 GAGAATGGACTAATACAATCTGG + Intergenic
1193801308 X:85939939-85939961 GAAAATGGACTAATAGAGGCAGG - Intronic
1193808172 X:86017671-86017693 GAAAACAGACTAATACAACAAGG + Intronic
1193827453 X:86243027-86243049 GAGAATGGACTAATATAGATGGG + Intronic
1193840527 X:86403776-86403798 GAAAACAGACTAATACACCATGG - Intronic
1193889521 X:87027510-87027532 GAAAATGGACTAATACAGTATGG + Intergenic
1194019875 X:88674266-88674288 GAAAATGAACTAATACAAGAGGG + Intergenic
1194126833 X:90029053-90029075 TAAAATGGACTAATACAGCAAGG - Intergenic
1194335456 X:92640853-92640875 GAAAATGGACTAATAAAAATGGG + Intergenic
1194352547 X:92839080-92839102 GAAAATGGATTAATACAGATGGG - Intergenic
1194354611 X:92866982-92867004 GAGAATGGATTAATACAATTGGG + Intergenic
1194478880 X:94395036-94395058 GAGAATGACCTAATACAGATGGG + Intergenic
1194755561 X:97734535-97734557 GAAAATGGACTAATAACGGCAGG + Intergenic
1194843784 X:98777182-98777204 GAGAATGGACTAATACAAACAGG + Intergenic
1195140835 X:101957933-101957955 GAAAACAGACTAATACAGGGAGG + Intergenic
1195141430 X:101964550-101964572 GAGAACGGACTAATACAGAGGGG - Intergenic
1195313994 X:103659969-103659991 GAGAACAGACTAATACAGGTGGG + Intergenic
1195565386 X:106333767-106333789 GAAAATAGACTAATACAGGAGGG + Intergenic
1195797755 X:108670744-108670766 AAAAATGGACTAATAGGGCCGGG + Intronic
1195807389 X:108790399-108790421 GAAAATGGACTAATAGAGTCTGG + Intergenic
1195844688 X:109213508-109213530 GAGAATGGACAAATACAGTCTGG - Intergenic
1196246447 X:113405060-113405082 GAGAATGGACTAATATACCTTGG + Intergenic
1196294870 X:113985990-113986012 GAAAACTGACTAATACAGAGGGG - Intergenic
1196301471 X:114053654-114053676 GAAAATGGACTAATACACTCAGG - Intergenic
1196480625 X:116142652-116142674 GAAAATGGACTAATACACCCAGG + Intergenic
1196970052 X:121098915-121098937 GATAATGGACTAATACAGATGGG - Intergenic
1196995332 X:121376805-121376827 GAAAACAGACTAATACAGGGGGG - Intergenic
1197003497 X:121468751-121468773 CAAAATGGGCTAACACAGGTGGG - Intergenic
1197430160 X:126352548-126352570 GAAAACAGACTAATACAGGCTGG + Intergenic
1197471819 X:126872810-126872832 GAGAATGGACTAATACAATATGG - Intergenic
1197520428 X:127490432-127490454 GAGAATGGACTAATACAATAGGG - Intergenic
1197568374 X:128117028-128117050 GAAAATGAACTAATACACAAAGG + Intergenic
1197608968 X:128617139-128617161 GAAAACAGACTAATACACCCTGG - Intergenic
1198083063 X:133257263-133257285 AAGAATGGACTAATACAACCTGG + Intergenic
1198083593 X:133262714-133262736 GAAAATGGACTAATACAATTGGG - Intergenic
1198477007 X:137004884-137004906 GAGAATGGGCTAATACAGAAGGG - Intergenic
1198626292 X:138579281-138579303 AAAAATGGACTAATACAGATGGG + Intergenic
1198764506 X:140066880-140066902 AAAAATGAAAAAATACAGCTGGG - Intergenic
1198863173 X:141092328-141092350 GACAATGAACTAATACAGGTTGG - Intergenic
1198899517 X:141495059-141495081 GACAATGAACTAATACAGGTTGG + Intergenic
1199032594 X:143017646-143017668 GAGAATGAACTAATACAGATAGG + Intergenic
1199219549 X:145301573-145301595 GAAAATGGACTAATGCAGTCAGG + Intergenic
1199338854 X:146651714-146651736 GAGAACGGACTAATACACCATGG - Intergenic
1199373665 X:147082567-147082589 GAAAACAGACTAATACATTTGGG + Intergenic
1199387506 X:147240378-147240400 GAAAATGGACTAACACAACAAGG - Intergenic
1199435700 X:147810200-147810222 GAGAATGGACTAATACAAATGGG + Intergenic
1199779960 X:151049473-151049495 GCAAATGGACTAAGGCAGCCTGG - Intergenic
1199925516 X:152459342-152459364 GAAAACGGACTAATACAATAGGG - Intergenic
1200643928 Y:5757887-5757909 GAAAATGGACTAATAAAAATGGG + Intergenic
1200660857 Y:5955819-5955841 GAAAATGGATTAATACAGATGGG - Intergenic
1200662974 Y:5984012-5984034 GAGAATGGATTAATACAATTGGG + Intergenic
1201012441 Y:9560901-9560923 GAAAATGAACTAATACAGGAGGG - Intergenic
1201186940 Y:11413919-11413941 GAAAACGGATTGATACAGTTTGG - Intergenic
1201355579 Y:13093918-13093940 GAAAATGCACAAATAAAGCAAGG + Intergenic
1201704478 Y:16921111-16921133 GAAAATGGACTAATGCAGGAAGG - Intergenic