ID: 1077998683

View in Genome Browser
Species Human (GRCh38)
Location 11:7475664-7475686
Sequence TATTGGGTGAGGAGGGGAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077998673_1077998683 17 Left 1077998673 11:7475624-7475646 CCCATTCCATTATCCATTTAGCA No data
Right 1077998683 11:7475664-7475686 TATTGGGTGAGGAGGGGAGAAGG No data
1077998676_1077998683 4 Left 1077998676 11:7475637-7475659 CCATTTAGCAAGAATATCAATCA No data
Right 1077998683 11:7475664-7475686 TATTGGGTGAGGAGGGGAGAAGG No data
1077998675_1077998683 11 Left 1077998675 11:7475630-7475652 CCATTATCCATTTAGCAAGAATA No data
Right 1077998683 11:7475664-7475686 TATTGGGTGAGGAGGGGAGAAGG No data
1077998674_1077998683 16 Left 1077998674 11:7475625-7475647 CCATTCCATTATCCATTTAGCAA No data
Right 1077998683 11:7475664-7475686 TATTGGGTGAGGAGGGGAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077998683 Original CRISPR TATTGGGTGAGGAGGGGAGA AGG Intergenic
No off target data available for this crispr