ID: 1078002826

View in Genome Browser
Species Human (GRCh38)
Location 11:7511903-7511925
Sequence CTGTGAAATAGGTAGGTAAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078002826_1078002831 -7 Left 1078002826 11:7511903-7511925 CCTATTACCTACCTATTTCACAG No data
Right 1078002831 11:7511919-7511941 TTCACAGATAGAAGGAATGTGGG No data
1078002826_1078002832 7 Left 1078002826 11:7511903-7511925 CCTATTACCTACCTATTTCACAG No data
Right 1078002832 11:7511933-7511955 GAATGTGGGCTGCCTCACAGAGG No data
1078002826_1078002834 15 Left 1078002826 11:7511903-7511925 CCTATTACCTACCTATTTCACAG No data
Right 1078002834 11:7511941-7511963 GCTGCCTCACAGAGGATAGTGGG No data
1078002826_1078002833 14 Left 1078002826 11:7511903-7511925 CCTATTACCTACCTATTTCACAG No data
Right 1078002833 11:7511940-7511962 GGCTGCCTCACAGAGGATAGTGG No data
1078002826_1078002830 -8 Left 1078002826 11:7511903-7511925 CCTATTACCTACCTATTTCACAG No data
Right 1078002830 11:7511918-7511940 TTTCACAGATAGAAGGAATGTGG No data
1078002826_1078002835 16 Left 1078002826 11:7511903-7511925 CCTATTACCTACCTATTTCACAG No data
Right 1078002835 11:7511942-7511964 CTGCCTCACAGAGGATAGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078002826 Original CRISPR CTGTGAAATAGGTAGGTAAT AGG (reversed) Intergenic
No off target data available for this crispr