ID: 1078003345

View in Genome Browser
Species Human (GRCh38)
Location 11:7514361-7514383
Sequence CGCGGATCCCAGGCAGGGTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 126
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 114}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078003345_1078003359 27 Left 1078003345 11:7514361-7514383 CCCAACCCTGCCTGGGATCCGCG 0: 1
1: 0
2: 1
3: 10
4: 114
Right 1078003359 11:7514411-7514433 CGTGGCCCTGGAGATGCGCAGGG 0: 1
1: 0
2: 0
3: 8
4: 142
1078003345_1078003360 30 Left 1078003345 11:7514361-7514383 CCCAACCCTGCCTGGGATCCGCG 0: 1
1: 0
2: 1
3: 10
4: 114
Right 1078003360 11:7514414-7514436 GGCCCTGGAGATGCGCAGGGAGG 0: 1
1: 0
2: 5
3: 44
4: 346
1078003345_1078003356 15 Left 1078003345 11:7514361-7514383 CCCAACCCTGCCTGGGATCCGCG 0: 1
1: 0
2: 1
3: 10
4: 114
Right 1078003356 11:7514399-7514421 TGCAGGTGCCAGCGTGGCCCTGG 0: 1
1: 0
2: 4
3: 36
4: 319
1078003345_1078003354 9 Left 1078003345 11:7514361-7514383 CCCAACCCTGCCTGGGATCCGCG 0: 1
1: 0
2: 1
3: 10
4: 114
Right 1078003354 11:7514393-7514415 CACTCCTGCAGGTGCCAGCGTGG 0: 1
1: 0
2: 0
3: 18
4: 198
1078003345_1078003358 26 Left 1078003345 11:7514361-7514383 CCCAACCCTGCCTGGGATCCGCG 0: 1
1: 0
2: 1
3: 10
4: 114
Right 1078003358 11:7514410-7514432 GCGTGGCCCTGGAGATGCGCAGG 0: 1
1: 0
2: 1
3: 7
4: 146
1078003345_1078003352 -2 Left 1078003345 11:7514361-7514383 CCCAACCCTGCCTGGGATCCGCG 0: 1
1: 0
2: 1
3: 10
4: 114
Right 1078003352 11:7514382-7514404 CGGACAGTCCGCACTCCTGCAGG 0: 1
1: 0
2: 0
3: 6
4: 59

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078003345 Original CRISPR CGCGGATCCCAGGCAGGGTT GGG (reversed) Intronic
900091615 1:923248-923270 TGTGGATCCGAGGCAGGGTGAGG - Intergenic
901187041 1:7380751-7380773 TTCTGATGCCAGGCAGGGTTAGG + Intronic
901353130 1:8616779-8616801 CGTGGCTGCCAGTCAGGGTTGGG - Intronic
902518614 1:17003181-17003203 AGCTGATCCCAGGCAGTGCTGGG - Intronic
902715539 1:18270197-18270219 AGTGGATGGCAGGCAGGGTTGGG - Intronic
903213001 1:21829084-21829106 GGAGGATGCCAGGCAGGGTTGGG + Intronic
903342893 1:22665681-22665703 TGAGAAGCCCAGGCAGGGTTCGG - Intergenic
904295585 1:29517836-29517858 TGCTGCTCCCAGGCAGGGTCTGG - Intergenic
912746795 1:112251986-112252008 ACTGGATCCCAGCCAGGGTTGGG - Intergenic
915603964 1:156939381-156939403 CGCCGATATCAGGCAGGCTTTGG - Intronic
915932669 1:160069906-160069928 CGCTGAGGCCAGGCAGGGTAGGG + Intronic
915953618 1:160205886-160205908 CGCGGAACCGAGACAGGGCTGGG - Intronic
922725314 1:227920319-227920341 AGCAGATCAGAGGCAGGGTTAGG + Exonic
924516474 1:244770270-244770292 CTCTGATCCCAAGCAGGGCTTGG + Intergenic
1064446007 10:15393622-15393644 GCTGGATCCCAGGCAGGGTTTGG + Intergenic
1069822665 10:71237108-71237130 CTAGGATCCCAGGCTGGGTGTGG + Intronic
1070791198 10:79190339-79190361 TGTGGATCCGAGGCAGGGTCAGG - Intronic
1073124448 10:101140818-101140840 CCAGGAACCCAGGCAGGGATGGG + Intergenic
1073313252 10:102559386-102559408 CTCTGATCCCAGGCAGGGCTGGG - Intronic
1077250688 11:1559375-1559397 CGCTGGGCCCAGGCAGGGGTGGG + Intronic
1078003345 11:7514361-7514383 CGCGGATCCCAGGCAGGGTTGGG - Intronic
1079535800 11:21513923-21513945 CTGGAATCCCAGGCAGGGGTGGG - Intronic
1081144273 11:39542268-39542290 CGCGGTTCTGAGGCTGGGTTGGG + Intergenic
1083987072 11:66222451-66222473 AGCAGATCACAGGCAGGGGTGGG + Intronic
1084266627 11:68008483-68008505 AGCGGGTGCCAGGCAGGGCTGGG - Intergenic
1084432108 11:69116871-69116893 CAGGGGTCCCAGGCAGGGTCGGG - Intergenic
1084471005 11:69358892-69358914 CTGGGATCCGAGGCAGGGGTGGG - Intronic
1084531516 11:69730570-69730592 CGAGGATCCCAGGGAGGGGCTGG + Intergenic
1090616870 11:128522586-128522608 CTCGGAGCCCAGGCAGGGGCGGG + Intronic
1092282533 12:7108792-7108814 CTCGGATCCCAGGGTGGGGTGGG - Intronic
1096186729 12:49586513-49586535 GGCAGATCCCAGGCAGGGAAGGG + Intronic
1096592165 12:52667603-52667625 AGCGGCTCCCAGGGAGGGTGAGG - Intergenic
1097173071 12:57128296-57128318 CGCGGACCCGCGACAGGGTTCGG - Intronic
1098110217 12:67113661-67113683 GACTGATGCCAGGCAGGGTTAGG + Intergenic
1118528123 14:66669012-66669034 CAGGGATTACAGGCAGGGTTTGG + Intronic
1122785573 14:104161909-104161931 CGCCGCTCCCTGGCAGTGTTGGG + Intronic
1122802308 14:104237831-104237853 AGTGGAGCCCAGGCAGGGTGTGG - Intergenic
1122940159 14:104977622-104977644 CGGGGCTTCCAGGCAGGGCTGGG - Intronic
1132150144 15:99453273-99453295 TGTGGGTCCCAGGCAGGCTTTGG - Intergenic
1132599898 16:768755-768777 CGGGGATCCCCAGCAGGGCTGGG - Exonic
1132703562 16:1231746-1231768 GGCTGGTCCCAGGCAGGGTGGGG - Intergenic
1132704948 16:1239615-1239637 GGCTGGTCCCAGGCAGGGTGGGG + Intergenic
1132707955 16:1254649-1254671 GGCTGGTCCCAGGCAGGGTGGGG + Intergenic
1144625013 17:16840092-16840114 TGCGGACCCCAGGCAGGTATGGG - Intergenic
1144881417 17:18432629-18432651 TGCGGACCCCAGGCAGGTATGGG + Intergenic
1144942108 17:18948870-18948892 AGGGGAGCCCAGGCAGGGTCGGG + Intergenic
1145150816 17:20511757-20511779 TGCGGACCCCAGGCAGGTATGGG - Intergenic
1145285636 17:21504118-21504140 TGCAGATCCCAGGCTGGCTTTGG + Intergenic
1149660328 17:58331414-58331436 CGGGGGGCCCTGGCAGGGTTGGG - Intergenic
1151217954 17:72590942-72590964 CCCTGGTCCCATGCAGGGTTTGG - Intergenic
1152530777 17:80917864-80917886 CGCTGAAACCAGGCAGGGGTGGG - Intronic
1160690128 19:457903-457925 TGCGGATGCCAGGCCTGGTTGGG - Intronic
1161894386 19:7069453-7069475 CGCGGGTCTGTGGCAGGGTTGGG - Exonic
1162759732 19:12881472-12881494 CCCGGTTCCCAGGCAAGTTTAGG - Intergenic
1162769029 19:12938088-12938110 CTCCCATCCCAGGCAGGGGTGGG + Intergenic
1163270198 19:16248450-16248472 TGCTGAACCCAGGCAGGGATTGG - Intergenic
1163361214 19:16847430-16847452 CTGGGGTCCCAGGCAGGGTGGGG - Intronic
1166807807 19:45497331-45497353 CGTGGATCCCTGGGTGGGTTGGG + Intronic
925200995 2:1967795-1967817 CGCTGTTCCCAGGCAGGGCTCGG - Intronic
925274399 2:2638490-2638512 CGCAGACCCAAGGGAGGGTTAGG - Intergenic
925377399 2:3397880-3397902 GGAGAATCCCAAGCAGGGTTTGG - Intronic
926170551 2:10550368-10550390 CGGGGAGGCCAGGCAGGGATGGG - Intergenic
933692666 2:85191412-85191434 AGCTGAGGCCAGGCAGGGTTTGG - Intronic
938646417 2:133335153-133335175 CATGGATACCAGGAAGGGTTGGG - Intronic
939530767 2:143358227-143358249 CACGGAGCCAAGGCAGGCTTTGG + Intronic
942361878 2:175181331-175181353 TGCGTAGCCCAGGCAGGGTCGGG - Intronic
946329297 2:219000668-219000690 GACAGATCCCAGGCAGGTTTAGG - Intergenic
948235197 2:236383085-236383107 CCAGGATCCCAGGAAGGTTTTGG + Intronic
948668021 2:239548411-239548433 CTCTGATCCCAGGAAGGGATTGG - Intergenic
1169296186 20:4402079-4402101 AGAGGATGCCAGGCAGGGTATGG - Intergenic
1170847061 20:19971325-19971347 CAAGGATCCCCGGCAGGGTTAGG - Intronic
1172195352 20:33087971-33087993 GCGGGAACCCAGGCAGGGTTCGG + Intronic
1173808095 20:45939181-45939203 CACGGAGCCCAGCCAGGGTCAGG - Intronic
1175084104 20:56444628-56444650 CTCGGATCCCTGGCTGGGTTTGG + Intronic
1175223196 20:57429223-57429245 GGAGGATCCCAGGCAGGCTGGGG - Intergenic
1175951907 20:62588053-62588075 CACGGATCCCAGGCAGGCAGTGG + Intergenic
1176045567 20:63090956-63090978 CGTGGATCCCAGGCTGGTGTGGG - Intergenic
1176060392 20:63169965-63169987 TGAGGATGCCAGGCAGGGGTGGG - Intergenic
1179430338 21:41316967-41316989 GGCGGGTCCCAGGCAGGGTTGGG - Intronic
1180816140 22:18791069-18791091 CGCGGATGCCAAGCAGTGCTTGG - Intergenic
1181202327 22:21225401-21225423 CGCGGATGCCAAGCAGTGCTTGG - Exonic
1184060683 22:42079314-42079336 CGGGGCTTCCAGGCAGGGCTGGG - Exonic
1203224583 22_KI270731v1_random:70012-70034 CGCGGATGCCAAGCAGTGCTTGG + Intergenic
1203266243 22_KI270734v1_random:16780-16802 CGCGGATGCCAAGCAGTGCTTGG - Intergenic
954134383 3:48575372-48575394 CCGGGCTCCCAGGCAGGGCTGGG - Exonic
954807620 3:53229602-53229624 CTCGGACCCCAGGGAGGGGTTGG - Intronic
955993756 3:64656766-64656788 CACGGAGGCCAGGCAGGGTTGGG + Intronic
959713982 3:109413038-109413060 GGGGGACCCCAGGCAGGGTCTGG + Intergenic
961204339 3:125068976-125068998 CAGGGACCCCAGGCAGGGCTTGG - Intergenic
961565701 3:127761885-127761907 TGAGGATCCCATGCAAGGTTTGG + Intronic
965530337 3:169764802-169764824 CGCGGCCTCCAGGCGGGGTTCGG + Intergenic
966588676 3:181654942-181654964 CCGGGATACCAAGCAGGGTTTGG + Intergenic
966945594 3:184775145-184775167 GGCGCAGCCCAGGCAGGGGTGGG - Intergenic
968534268 4:1113501-1113523 CGCGAAGCCCACGCAAGGTTGGG + Exonic
976218914 4:82740400-82740422 GGAGGATCTCAGGCTGGGTTTGG + Intronic
986336646 5:6760313-6760335 CGCAGAGCCCTGGAAGGGTTTGG + Intergenic
1001487519 5:172130088-172130110 AGGGGTTCCCAGCCAGGGTTTGG - Intronic
1004205828 6:13591498-13591520 GGCAGATGCCAGGCAGGGTCTGG - Intronic
1006514100 6:34536542-34536564 CTCAGATCTCAGGCAGGGGTTGG - Intergenic
1006625156 6:35392550-35392572 CGAGGAACCCAGGCAGGCTGAGG - Intronic
1016556942 6:145349532-145349554 CTCGGACACCAGGCTGGGTTTGG - Intergenic
1019184352 6:170212465-170212487 CCCGGAGCCCAGGCAGGGTGTGG + Intergenic
1019416909 7:932035-932057 CCCGGCCCCCAGGCAGGGCTGGG - Intronic
1019931661 7:4227325-4227347 GGCTGATCCCAGGAAGGGGTGGG - Intronic
1022489450 7:30805409-30805431 CGCAGATCCCAGGGAATGTTGGG + Intronic
1027270343 7:76515330-76515352 CTGGGATTCCAGGCAGGGTACGG - Exonic
1029607249 7:101606415-101606437 CAGGGAACACAGGCAGGGTTGGG - Intergenic
1031994669 7:128222051-128222073 TGAGAATCTCAGGCAGGGTTAGG - Intergenic
1041367732 8:57126697-57126719 CTCGGAACCTACGCAGGGTTTGG - Intergenic
1042560887 8:70071440-70071462 CTAGGGTCCCAGGGAGGGTTTGG - Intronic
1045343796 8:101276542-101276564 CTGGCATCCCAGGCACGGTTAGG - Intergenic
1046271139 8:111899057-111899079 CATGGGTCCCAGGCAAGGTTGGG + Intergenic
1049032316 8:140047096-140047118 GGCGGGGCCCAGGCAGGGTTGGG - Intronic
1049658865 8:143810852-143810874 GGTGGCTCTCAGGCAGGGTTTGG - Intronic
1049814231 8:144590775-144590797 CTCTGTTCCCAGGCAGGGCTAGG - Intronic
1053020139 9:34688979-34689001 CCCTGACCCCAGGCTGGGTTAGG - Intergenic
1058144753 9:101399035-101399057 CGAGGATCCCTGGCTGGGTCTGG - Exonic
1060939964 9:127537575-127537597 AGGGGATCCCAGCCACGGTTAGG - Intronic
1061420691 9:130471641-130471663 CGGGGAACACAGGCAGGGCTCGG - Intronic
1062216013 9:135390276-135390298 CGTGGTTCCCAGGCAGGGCTGGG + Intergenic
1062293595 9:135811090-135811112 AGAGGATGCCAGGCAGGGTGAGG - Exonic
1185461364 X:334089-334111 CCCGGAACCCAGGCTGGGTCGGG + Exonic
1185604367 X:1359345-1359367 TGCAGATCCCAGGCAGGGGCTGG - Intronic
1197326908 X:125105652-125105674 CTCAGATCCCAGGCAGGGAGAGG + Intergenic
1199804272 X:151282309-151282331 CAAGAATCCCAGGCAGGGTGTGG - Intergenic
1200036750 X:153335906-153335928 CAAGGAGCCCAGGCAGGTTTGGG - Intronic