ID: 1078005671

View in Genome Browser
Species Human (GRCh38)
Location 11:7530603-7530625
Sequence CTCTGCTGGTGCCTTGATCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2784
Summary {0: 1, 1: 13, 2: 227, 3: 751, 4: 1792}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078005667_1078005671 6 Left 1078005667 11:7530574-7530596 CCAAGAAGCAATCCTGCTCCAGA 0: 1
1: 0
2: 1
3: 15
4: 240
Right 1078005671 11:7530603-7530625 CTCTGCTGGTGCCTTGATCCTGG 0: 1
1: 13
2: 227
3: 751
4: 1792
1078005668_1078005671 -6 Left 1078005668 11:7530586-7530608 CCTGCTCCAGACACTGACTCTGC 0: 1
1: 1
2: 16
3: 436
4: 1334
Right 1078005671 11:7530603-7530625 CTCTGCTGGTGCCTTGATCCTGG 0: 1
1: 13
2: 227
3: 751
4: 1792
1078005666_1078005671 17 Left 1078005666 11:7530563-7530585 CCATCTGTGAACCAAGAAGCAAT 0: 2
1: 1
2: 10
3: 81
4: 511
Right 1078005671 11:7530603-7530625 CTCTGCTGGTGCCTTGATCCTGG 0: 1
1: 13
2: 227
3: 751
4: 1792

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078005671 Original CRISPR CTCTGCTGGTGCCTTGATCC TGG Intronic
Too many off-targets to display for this crispr