ID: 1078007304

View in Genome Browser
Species Human (GRCh38)
Location 11:7541567-7541589
Sequence GCTGCATGGTGGAGTGTTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 178
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 166}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078007294_1078007304 5 Left 1078007294 11:7541539-7541561 CCTTTGTCCATTCCTCTTCTCCC 0: 1
1: 0
2: 5
3: 97
4: 794
Right 1078007304 11:7541567-7541589 GCTGCATGGTGGAGTGTTTCAGG 0: 1
1: 0
2: 1
3: 10
4: 166
1078007292_1078007304 15 Left 1078007292 11:7541529-7541551 CCTCCTGTCTCCTTTGTCCATTC 0: 1
1: 0
2: 2
3: 48
4: 463
Right 1078007304 11:7541567-7541589 GCTGCATGGTGGAGTGTTTCAGG 0: 1
1: 0
2: 1
3: 10
4: 166
1078007298_1078007304 -7 Left 1078007298 11:7541551-7541573 CCTCTTCTCCCCGGTGGCTGCAT 0: 1
1: 0
2: 2
3: 26
4: 275
Right 1078007304 11:7541567-7541589 GCTGCATGGTGGAGTGTTTCAGG 0: 1
1: 0
2: 1
3: 10
4: 166
1078007297_1078007304 -2 Left 1078007297 11:7541546-7541568 CCATTCCTCTTCTCCCCGGTGGC 0: 1
1: 0
2: 2
3: 20
4: 311
Right 1078007304 11:7541567-7541589 GCTGCATGGTGGAGTGTTTCAGG 0: 1
1: 0
2: 1
3: 10
4: 166
1078007293_1078007304 12 Left 1078007293 11:7541532-7541554 CCTGTCTCCTTTGTCCATTCCTC 0: 1
1: 0
2: 7
3: 50
4: 575
Right 1078007304 11:7541567-7541589 GCTGCATGGTGGAGTGTTTCAGG 0: 1
1: 0
2: 1
3: 10
4: 166

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078007304 Original CRISPR GCTGCATGGTGGAGTGTTTC AGG Intronic
900784178 1:4637301-4637323 GCTGCTTCCTGGAGTGTTTCGGG + Intergenic
903404963 1:23088538-23088560 GCTCCTTGGTGGGTTGTTTCTGG - Exonic
910324533 1:85990345-85990367 GCGGCATGGAGGATAGTTTCGGG + Intronic
913107687 1:115629547-115629569 GCTGAATGTGGGGGTGTTTCAGG - Intergenic
913486871 1:119339826-119339848 GCTGCATATTGGAGGGTTGCTGG + Intergenic
914774403 1:150722650-150722672 GCTGCATGTTGGGGTGTCTGTGG + Intergenic
915361054 1:155286616-155286638 GCTGCCTGGTGGCGTGTTTCAGG + Intronic
1064837436 10:19549435-19549457 GCTGAAGGGTGGAGTGGTTGTGG - Intronic
1065797851 10:29323524-29323546 GCTGCATGAAGGAGTTTATCTGG + Intergenic
1066802429 10:39206464-39206486 GCTGTGTGGTGGGGTGTTGCTGG - Intergenic
1068476363 10:57531758-57531780 GCTGCATGGGGGAGAACTTCTGG - Intergenic
1068780592 10:60915650-60915672 AGGGCATGGTGGAGTGGTTCTGG + Intronic
1069825720 10:71253889-71253911 GCTGCAAGGTGGAGGGTCCCAGG + Intronic
1069851207 10:71406270-71406292 GCAGCAACGTGGAGTGTTTGAGG + Intronic
1074868759 10:117561055-117561077 GCTGCTTTGGGGAATGTTTCTGG - Intergenic
1075077461 10:119360686-119360708 GCTCCATGGTCAAGTGTTTGAGG + Intronic
1076079237 10:127563768-127563790 GCTGCCTGGTGAACTGTTCCAGG - Intergenic
1076232901 10:128836677-128836699 GCTGCATGCTGATGTGTTTCGGG + Intergenic
1076324348 10:129609469-129609491 GCTGGATGGTGGAGGTTTGCTGG + Intronic
1078007304 11:7541567-7541589 GCTGCATGGTGGAGTGTTTCAGG + Intronic
1081090746 11:38863297-38863319 GCTTTATGGAGGAGTGTTTAGGG + Intergenic
1083726979 11:64633731-64633753 GATGCATGGTGATGTGTGTCAGG - Intronic
1084944559 11:72631790-72631812 GCTGCAGGGTGGTGGGCTTCTGG - Intronic
1085830884 11:79899666-79899688 GCTGTATTTTGGAGTTTTTCTGG - Intergenic
1087077371 11:94137554-94137576 GCTGCATGCTGTGGGGTTTCTGG + Intronic
1089058222 11:115604956-115604978 TTTGCATGCTGAAGTGTTTCAGG + Intergenic
1090008116 11:123020636-123020658 GCAGCTTGGTTGGGTGTTTCTGG + Intergenic
1093768120 12:22988307-22988329 GCTGAAGGGTGGAGTGATTCAGG - Intergenic
1096748200 12:53742369-53742391 TCTGGATGGAGGAGTGTGTCTGG + Intergenic
1097407354 12:59206324-59206346 GCTTTTTGGTGGAGTGTTTTGGG - Intergenic
1098937500 12:76497382-76497404 GATTCCTGGTGTAGTGTTTCAGG + Intronic
1101303125 12:103502195-103502217 GGTGGAGGGTGGAGTGTTTCAGG - Intergenic
1102444323 12:112990032-112990054 GCTGCAGGGTGGAGTGAGACAGG - Intronic
1102819601 12:115896464-115896486 GTGGAATGGTGGAGTGTTTGGGG - Intergenic
1104008394 12:124911971-124911993 GGTGCAGGGTGGACTCTTTCTGG + Exonic
1104008426 12:124912199-124912221 GGTGCAGGGTGGACTCTTTCTGG + Exonic
1104008458 12:124912427-124912449 GGTGCAGGGTGGACTCTTTCTGG + Exonic
1104008490 12:124912655-124912677 GGTGCAAGGTGGACTCTTTCTGG + Exonic
1104008551 12:124913111-124913133 GGTGCAAGGTGGACTCTTTCTGG + Exonic
1104008617 12:124913567-124913589 GGTGCAGGGTGGACTCTTTCTGG + Exonic
1104157143 12:126144317-126144339 GCTGCAGGGTAGGGTGTTTCCGG - Intergenic
1105757497 13:23481964-23481986 ACTGCCTGGTGGAGTGTTAAAGG - Intergenic
1107448898 13:40491188-40491210 GTTGATTGGTGGAGTGCTTCAGG + Intergenic
1109543022 13:63804104-63804126 ACAGCATGTTGGACTGTTTCAGG + Intergenic
1111851943 13:93586902-93586924 GTTTCATGGTGAAATGTTTCAGG + Intronic
1112012094 13:95301205-95301227 GCTGCAGGGTGACCTGTTTCGGG + Intronic
1112731392 13:102367156-102367178 GCAGCTTAGTGGAGTGGTTCTGG + Intronic
1114303455 14:21399107-21399129 CCTGCAGGGTGGACTCTTTCTGG - Intronic
1114572523 14:23682883-23682905 GCTGGATGGTGGGGTGATGCAGG - Intergenic
1116141328 14:40998614-40998636 GCTGCATGCTGGAGTCTGTCAGG + Intergenic
1118760242 14:68876584-68876606 ACTGCCAGGTGGAGTGTTGCAGG + Intronic
1121696717 14:95919378-95919400 GCAGCATGCTGCAGTGTTTACGG + Intergenic
1122414349 14:101541758-101541780 GCTCCATGATGGAGTGGTTCTGG + Intergenic
1125350003 15:38756380-38756402 GCTGCATGGAGGAGCCTTTATGG + Intergenic
1128916029 15:71563260-71563282 GAGGCATGGTGGAGTCTTGCTGG + Intronic
1128930644 15:71702195-71702217 GCTGCAGGGTCCAGTGGTTCTGG - Intronic
1129081413 15:73044472-73044494 GCTAGATGGTAGAGTGTTTGAGG - Intergenic
1131668879 15:94598310-94598332 GCTGCATGGTAGAGTCTTCAGGG + Intergenic
1131874441 15:96789854-96789876 ACTGCGTGGTGGTGTGTTTTCGG - Intergenic
1139264563 16:65626710-65626732 GCTCCATGGTGCAGTGCTTAGGG + Intergenic
1139992973 16:70954640-70954662 GCTGCATGGTGGAGAATTGAAGG - Intronic
1141672514 16:85500061-85500083 GCTCCGTGGTGGGGTGTTTAGGG - Intergenic
1141778048 16:86137654-86137676 CCTGTATTCTGGAGTGTTTCTGG - Intergenic
1142105547 16:88300519-88300541 GCTGCTAGGTGGTGGGTTTCTGG - Intergenic
1142275819 16:89118375-89118397 GCTGCATTTTGGAGTTTTTGTGG - Intronic
1142778077 17:2157368-2157390 GCTGCATGTATGAGTGTTTGTGG - Intronic
1143933117 17:10452114-10452136 GCTGCAGGGTGGACTCTTCCAGG + Exonic
1145180070 17:20741510-20741532 GGTGCATGGTGGGGTTTTTTTGG - Intergenic
1149565299 17:57636780-57636802 TCTGCCTGGTGCAGTGCTTCTGG + Intronic
1152252477 17:79219159-79219181 GCTGCAGGGTAGATTGTGTCTGG + Intronic
1153725214 18:7947213-7947235 GCTGCATGGTGGAATTGTTATGG + Intronic
1157307923 18:46530416-46530438 GATTCATGCAGGAGTGTTTCTGG + Intronic
1160268017 18:77357490-77357512 GCTCCTTGGTGGAGCTTTTCTGG - Intergenic
1164452649 19:28380253-28380275 GCTGCATCCTGGAGTGTTCAGGG - Intergenic
1165791231 19:38493872-38493894 GGTGCATGGCGAAGTGCTTCTGG + Intronic
1167888741 19:52522904-52522926 TCTGATTGGTGGATTGTTTCTGG + Intergenic
927282532 2:21321995-21322017 ACAGCATGGTGGAGGGTTTAAGG - Intergenic
927640786 2:24844176-24844198 CCTTCAGGGTGGAGTGCTTCCGG + Intronic
928322951 2:30297776-30297798 GCTGCTTGGTGCAGCGTTCCAGG + Intronic
936265225 2:110999883-110999905 GCTGCTTGATGGTGTGGTTCTGG - Intronic
936920366 2:117682707-117682729 GCTGAAGGGTGGAGTGGTTGTGG - Intergenic
937543599 2:122988884-122988906 GCTCCAAGGGGGAGTGTCTCTGG + Intergenic
938382281 2:130843402-130843424 CCTGCATGGTGGAGTGGGTGGGG + Intronic
938926880 2:136051486-136051508 GCTGTTTGCTGGAGGGTTTCTGG + Intergenic
939362801 2:141195623-141195645 GCTGCATGATGGATAATTTCAGG - Intronic
944437643 2:199707119-199707141 GCCCCATGGTAAAGTGTTTCTGG + Intergenic
944811292 2:203329066-203329088 GCTGCAGAGTGAAGTGCTTCAGG + Intronic
945909820 2:215635708-215635730 GAAGCATGGTGGAGGGGTTCAGG + Intergenic
947272353 2:228351327-228351349 GCTGGATTGTGGGGAGTTTCTGG + Intergenic
948267327 2:236644655-236644677 GCTGAATGGTGGATGGCTTCTGG - Intergenic
948346976 2:237306781-237306803 ACTGAATGGTGGAGTGATGCTGG + Intergenic
1168855199 20:1002880-1002902 CCTGCAGGGTGGGGTGTTTGCGG + Intergenic
1168875264 20:1167239-1167261 GGAGCAAGTTGGAGTGTTTCAGG + Exonic
1169430691 20:5533508-5533530 TCTGCATGTTGCAGTGTTTTGGG + Intergenic
1169482867 20:6001130-6001152 CCTGGATGGGGGAATGTTTCGGG + Intergenic
1171157618 20:22890798-22890820 GCTGCATGGTGTTGGGTTGCAGG - Intergenic
1172784470 20:37458006-37458028 GCAGCCTGGTTGAGTGTTTCTGG + Intergenic
1180167877 21:46039354-46039376 GCTGTGTGGTGGGGTGTGTCGGG - Intergenic
1180910236 22:19444784-19444806 GCTGCAGGGAGGAGTGTGTTAGG + Intronic
1181310633 22:21942791-21942813 TCTGCATGGTGCAGTGACTCAGG - Intronic
1182797131 22:32999204-32999226 ACTGCAGGGTGGGGTGTGTCAGG + Intronic
1184604858 22:45566620-45566642 GCTGCCTGCTGGACTATTTCAGG - Intronic
952094598 3:29934185-29934207 GCTGCATGTTGGAATGTCTAAGG + Intronic
952406456 3:33009202-33009224 CCTTAATGGTGGAATGTTTCAGG + Intronic
957262793 3:77922400-77922422 ACTGCAAGGTGGACTGTCTCTGG + Intergenic
959666646 3:108930204-108930226 GCTGCAGGCTGTAGTCTTTCTGG + Intronic
961636862 3:128338710-128338732 GCTGCATGGTGGAGGCTTCCTGG + Intronic
961668411 3:128508736-128508758 GCTCCAGGGTGGACTGTCTCAGG + Intergenic
967001730 3:185342195-185342217 GCAGCATGGGTGAGTGGTTCTGG - Intronic
967114861 3:186327987-186328009 GCTGGAAGGTGGAGTGTGTGGGG - Intronic
968963882 4:3759698-3759720 GCTGCAGGATGCAGTGCTTCTGG - Intergenic
969863594 4:10057052-10057074 GCTGCATGGAGGAACGTTGCAGG - Intergenic
970502200 4:16689498-16689520 GCTCTATGGTGGAGTCTTTGTGG + Intronic
970515784 4:16828874-16828896 GCTGCAGGGTGCCGTGTTGCAGG - Intronic
971013523 4:22464636-22464658 GCTGCATGGGGAAGAGTTGCAGG - Intronic
975737025 4:77390921-77390943 TTTCCATGGTGGAGTCTTTCTGG + Intronic
976899144 4:90152451-90152473 GCTGCATGATGGAGAATTTTGGG + Intronic
981289149 4:143053749-143053771 GCTGGATGGTGGAGGGTGTGAGG - Intergenic
981310587 4:143294341-143294363 GTTGCAGGGTGGAATGTTTGTGG + Intergenic
984847817 4:184122528-184122550 GCTGCATGCTGGTGTCTCTCAGG + Intronic
988529646 5:32016524-32016546 GCTCCATGCTGGTGTCTTTCAGG - Intronic
988533795 5:32048636-32048658 GCTGCGGGAGGGAGTGTTTCCGG - Exonic
994208640 5:97063388-97063410 ACAGTAGGGTGGAGTGTTTCTGG + Intergenic
994944791 5:106373268-106373290 GCTGCATGCTGTTGAGTTTCTGG - Intergenic
997613493 5:135231080-135231102 GGGGCATGGAGGGGTGTTTCAGG + Intronic
997918956 5:137958918-137958940 TTTGCATGCTGGAGTGTTTATGG - Intronic
998324162 5:141264233-141264255 GCTGGATAGAGGAGTGTTTAGGG - Intergenic
999927619 5:156396444-156396466 GTTGCAGGGTGGAGGGTATCAGG + Intronic
1001257576 5:170196095-170196117 GCTCCATGGTGTGGTGTTACTGG - Intergenic
1002356963 5:178637827-178637849 GCTCCATGGTGCAGTGTTGGTGG - Intergenic
1005456347 6:26023322-26023344 GCTGCATTCTGGATAGTTTCAGG + Intergenic
1006727735 6:36211832-36211854 GCTGGATTGTGGGGAGTTTCAGG + Intronic
1008411168 6:51181304-51181326 GCTGCATGTTGGGGCTTTTCTGG + Intergenic
1009933409 6:70203732-70203754 GGTGCTTGGTGTAGTTTTTCAGG - Intronic
1011609625 6:89138282-89138304 TCTGCATGGTCAAGTGTTCCTGG + Intergenic
1012449184 6:99337064-99337086 GCTGCATGTTGAAGTATTGCAGG + Intronic
1015731402 6:136351958-136351980 GATTCATGGTAGAGTGCTTCTGG + Intronic
1019090813 6:169531524-169531546 GCTGGATGCTGGGGTGCTTCTGG - Intronic
1019515430 7:1437943-1437965 GCCTCATGGTGGACTGGTTCTGG - Exonic
1019871157 7:3763540-3763562 TATGCATGGTGAAGTGTTTAGGG - Intronic
1022036219 7:26537361-26537383 GCTGCATGGTGGAGTGGAAAGGG + Intronic
1022191534 7:28021006-28021028 TCTGCAAGATGGAGGGTTTCTGG - Intronic
1023240410 7:38140246-38140268 GCTGCATGCTGAAGTGTTTAGGG + Intergenic
1023777309 7:43620140-43620162 GATCCATGGTTGAGTGCTTCTGG + Intronic
1023799152 7:43818391-43818413 GCTGCATGGTAGCTTTTTTCCGG + Intergenic
1023828640 7:44026434-44026456 GCTACATAGTGGAATGTTTATGG - Intergenic
1024376201 7:48641658-48641680 GTTGCATGGAGATGTGTTTCTGG - Intronic
1027613404 7:80390930-80390952 GGTGCATGGTGTAATGTTTAAGG + Intronic
1028873407 7:95793515-95793537 GCTGCAAGGTGGGGAGTCTCTGG + Intronic
1029738937 7:102480714-102480736 GCTACATAGTGGAATGTTTATGG - Intergenic
1029756938 7:102579877-102579899 GCTACATAGTGGAATGTTTATGG - Exonic
1029774877 7:102678937-102678959 GCTACATAGTGGAATGTTTATGG - Intergenic
1034462027 7:151203328-151203350 TCTGCATTCTGGAGTCTTTCAGG + Intronic
1035075641 7:156175513-156175535 CCTGCATGGCTGAGAGTTTCTGG + Intergenic
1040007984 8:42636870-42636892 GCTGCGGTGTGGAGTTTTTCGGG + Intergenic
1040330837 8:46384981-46385003 GCTGCAAGGTGGCGTGGTTGGGG + Intergenic
1043738809 8:83780941-83780963 GTTTCCTGGTGGAGTCTTTCGGG + Intergenic
1044401952 8:91783038-91783060 GCAGCAGGGTGGAGTATGTCTGG - Intergenic
1044457723 8:92407458-92407480 GATGCTTGTTGGAGGGTTTCAGG + Intergenic
1047211088 8:122841122-122841144 GCTGCCAGGTGGAGCGTTGCTGG + Intronic
1049676364 8:143891045-143891067 GCTGCGAGGAGGAGTGCTTCTGG - Intergenic
1049776370 8:144407573-144407595 GCTACTTGGTGGAGGGTTTAGGG + Intronic
1053274278 9:36771411-36771433 GCTGCATCGGGAAGTGTCTCAGG - Intergenic
1055042333 9:71888422-71888444 TGTGCATTGTGGAATGTTTCTGG - Intronic
1055445518 9:76378276-76378298 GCTGCTAGCTGGATTGTTTCAGG - Intergenic
1058064522 9:100534068-100534090 GCTGTGTGGGGAAGTGTTTCAGG + Intronic
1059771565 9:117431267-117431289 GCTGAATGCTGGTGTGTTCCGGG + Intergenic
1185916701 X:4043649-4043671 GCTGCATGGGGGACTGATACAGG - Intergenic
1187568836 X:20480166-20480188 GCTGCATGTTAGAATGTTTGAGG + Intergenic
1187693305 X:21893520-21893542 GCTGGATGGTGGAGTGGGTGGGG + Intergenic
1188320321 X:28728425-28728447 GCTGTATGTTGGACTGTTTGTGG - Intronic
1188535699 X:31194439-31194461 GGTGTATGGTGAAGTGTTTAGGG + Intronic
1190777498 X:53564722-53564744 GCTGGTTGGTTGATTGTTTCAGG - Exonic
1192214465 X:69149131-69149153 GCTGCATGGGGAAGTGGTTAAGG - Intergenic
1192607176 X:72530316-72530338 GCTGCATGGTACAGCATTTCAGG - Intronic
1196408955 X:115395906-115395928 TCAGCATGGAGGAGTCTTTCTGG + Intergenic
1197215271 X:123860624-123860646 GGAGCAGGGTGGAGTGTGTCTGG + Intronic
1197688708 X:129473995-129474017 CATGCATGTTGAAGTGTTTCTGG + Intronic