ID: 1078008207

View in Genome Browser
Species Human (GRCh38)
Location 11:7548416-7548438
Sequence CCTGTTCTCCACAGCGTGTA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 79
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 69}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078008199_1078008207 21 Left 1078008199 11:7548372-7548394 CCTGTTTCCTCTGCTGCACCATG 0: 1
1: 0
2: 4
3: 28
4: 428
Right 1078008207 11:7548416-7548438 CCTGTTCTCCACAGCGTGTATGG 0: 1
1: 0
2: 0
3: 9
4: 69
1078008198_1078008207 24 Left 1078008198 11:7548369-7548391 CCACCTGTTTCCTCTGCTGCACC 0: 1
1: 0
2: 3
3: 41
4: 475
Right 1078008207 11:7548416-7548438 CCTGTTCTCCACAGCGTGTATGG 0: 1
1: 0
2: 0
3: 9
4: 69
1078008202_1078008207 3 Left 1078008202 11:7548390-7548412 CCATGCTTGAGTGTGGAAGCCGT 0: 1
1: 0
2: 0
3: 13
4: 108
Right 1078008207 11:7548416-7548438 CCTGTTCTCCACAGCGTGTATGG 0: 1
1: 0
2: 0
3: 9
4: 69
1078008200_1078008207 14 Left 1078008200 11:7548379-7548401 CCTCTGCTGCACCATGCTTGAGT 0: 1
1: 0
2: 3
3: 9
4: 155
Right 1078008207 11:7548416-7548438 CCTGTTCTCCACAGCGTGTATGG 0: 1
1: 0
2: 0
3: 9
4: 69

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078008207 Original CRISPR CCTGTTCTCCACAGCGTGTA TGG Intronic
900689723 1:3973381-3973403 CCTATTCCCCACAGTGTCTATGG + Intergenic
900689746 1:3973471-3973493 CCTATTCCCCACAGTGTCTATGG + Intergenic
913185110 1:116363709-116363731 CCTGTTCTCCTTAGCTTCTACGG + Intergenic
915322779 1:155064877-155064899 CCTGTTCTCCAGAGAGTCTGTGG - Intronic
915580876 1:156812587-156812609 GCTGTTCTACACAGGGTGTCAGG - Intronic
924262368 1:242245460-242245482 CCTGTTCAGCACAGCGTGTGGGG + Intronic
1063000510 10:1914245-1914267 CCTGTGCTCCAAAGCTTTTATGG - Intergenic
1078008207 11:7548416-7548438 CCTGTTCTCCACAGCGTGTATGG + Intronic
1090420476 11:126571943-126571965 CCTGTTCCTCACAGGGTGTGTGG - Intronic
1090423811 11:126593421-126593443 CCTGGTCCCCACAGTGGGTAGGG - Intronic
1096263041 12:50104758-50104780 CCTGTTCTTCGCAGGGTGTTGGG - Intronic
1098123730 12:67269248-67269270 TCTCTTCTCCACAGCGTGCGTGG + Intergenic
1099356726 12:81646326-81646348 CCTGTTCTCTAGAGGGTCTAGGG - Intronic
1110543323 13:76729280-76729302 CATGTTGTCCACTCCGTGTATGG - Intergenic
1113466913 13:110519532-110519554 ACTCTTCTCCACAGTGTGCAGGG - Intergenic
1115763689 14:36601007-36601029 CCTGTTCCCCACATCATGGAGGG + Intergenic
1122278001 14:100605105-100605127 CCTGGTCTCCACAGGGAGGAGGG + Intergenic
1127862679 15:63007392-63007414 CATGCTCTCCACAGCTTCTAGGG - Intergenic
1137446236 16:48534279-48534301 CCTCCTCTCCCCAGCGTGGAAGG - Intergenic
1142489224 17:267078-267100 CCTGTTCTCAGCAGCTTGTAGGG - Intronic
1142893593 17:2960541-2960563 CCTGCTGTCCACAGAGTGTGGGG + Intronic
1144834373 17:18149202-18149224 CCTTTTCTCCACAGGGTGTTTGG + Exonic
1150584031 17:66501437-66501459 CCTTCTCTACTCAGCGTGTATGG - Intronic
1150901842 17:69287692-69287714 CCTGTTCTCGACATATTGTATGG - Exonic
1151248643 17:72816240-72816262 CCTGTTCTCCCCAACATGTAGGG - Intronic
1152371890 17:79893400-79893422 CCTGTGCTCCACAGCCTGCTTGG + Intergenic
1152466134 17:80467501-80467523 CCTGTTCTCAAAAGCATGTTGGG - Exonic
1155739175 18:29265372-29265394 CCTCTTCTCCACACCCAGTATGG - Intergenic
1160418408 18:78727639-78727661 CCTGTTGTCCTCAGCATGTCAGG - Intergenic
1161517610 19:4705030-4705052 ACTGCTTTCCACAGAGTGTAGGG - Intronic
1162373126 19:10290600-10290622 CGTGTTCTTCACCGGGTGTAGGG + Intronic
1165017484 19:32891293-32891315 CCTCTTCACCACAGCCTGCAGGG + Intronic
1166384287 19:42371516-42371538 CCTGACCTCCACAAGGTGTAGGG - Intronic
927743736 2:25596080-25596102 CCTGTTTTCCACAGCAGGTAAGG - Exonic
931915612 2:66951661-66951683 CCTGTTATGCCCAGCGTGAAGGG - Intergenic
936273228 2:111068359-111068381 CCTCTTCACCACAGCATATAAGG - Intronic
939517569 2:143188534-143188556 CATGTTCTGCACTGCGTGTTAGG - Intronic
939979499 2:148761909-148761931 CCTTTTCTCCACAACTTCTAAGG - Exonic
944085198 2:195837807-195837829 CCTGTTGTACACAGAATGTAAGG + Intronic
947855829 2:233323893-233323915 CTTGTTCTCCACAGCATCTGTGG - Intronic
947998245 2:234546305-234546327 GCTGTTCTCCACAGGATGAATGG + Intergenic
1169942929 20:10957125-10957147 GCTGTTCTCCACTGGGGGTAAGG - Intergenic
1170486901 20:16827142-16827164 CCTTTTCTCCACAGCCTCAACGG - Intergenic
1175508454 20:59504370-59504392 CCAGTTCTCCACAGACTGAAGGG - Intergenic
1179144936 21:38759762-38759784 CCTGGTCTCCACAGCCTCTCAGG - Intergenic
1179661511 21:42879018-42879040 CCAGTTCTGCAGAGCGTGTTCGG + Intronic
949516588 3:4813170-4813192 CCTGTTCTCCGATGTGTGTAGGG + Exonic
951266595 3:20575126-20575148 CCAGTTCTCCTCAGCATGTCAGG - Intergenic
951284197 3:20789407-20789429 CCTGTACTCCACAGTCTGCATGG + Intergenic
954513229 3:51146729-51146751 CCTATTCTCCCCAGTGTATATGG - Intronic
961053750 3:123768800-123768822 CCTGTTCACCAGACAGTGTATGG - Intronic
974396033 4:61336562-61336584 CTTGTTTTCCTCAGCGTGTGAGG + Intronic
986497486 5:8359889-8359911 CCTGGTCCACACAGCGTGTCAGG + Intergenic
989513503 5:42315911-42315933 CCTGGTCCCCACAGCATGGAAGG + Intergenic
990158357 5:52905887-52905909 CCTGTTCTCCACTGAGCGTCTGG - Exonic
990449153 5:55919022-55919044 CCTGTTCTCCACCCCTTCTATGG + Intronic
991732861 5:69605794-69605816 CTTGTTCTCCATAGAGTGAAAGG + Intergenic
996258071 5:121429769-121429791 CTTGTTTTCCACATCATGTAAGG - Intergenic
1002711049 5:181195262-181195284 CATGTCCTCCACAGCGTAGAAGG + Exonic
1002844423 6:934384-934406 AATGTTCTCCACAACTTGTAAGG + Intergenic
1003047161 6:2744417-2744439 CCTGTGCTCCTCACCCTGTAAGG - Intronic
1006331297 6:33392998-33393020 CCTTTTCTCCACAGCACTTACGG - Intronic
1010227140 6:73501354-73501376 CCTATTATCCACAGTGTGGATGG + Intronic
1015628800 6:135209871-135209893 CCTTTTCTCCACATTGTGTGGGG + Intronic
1020079062 7:5276766-5276788 TCTGATCTCCACTGCGTGTACGG + Intronic
1022346001 7:29515268-29515290 CCTGGTCTCCACAGCTTGGAAGG + Intergenic
1022945881 7:35282995-35283017 GGTGTCCTCCACAGCGTGTCAGG + Intergenic
1024359519 7:48454290-48454312 GCTGCTCTCCACAGCTTGTTTGG + Intronic
1025199836 7:56955412-56955434 TCTGATCTCCACTGCGTGTACGG - Intergenic
1025672109 7:63621520-63621542 TCTGATCTCCACTGCGTGTACGG + Intergenic
1029386783 7:100248623-100248645 CCTGTACTGTACAGCGTGGATGG - Intronic
1034397038 7:150834812-150834834 CCTTTTCTCCACAGCTTTGATGG - Intronic
1036604339 8:10292823-10292845 CCTGCTGTCCCCAGCCTGTAGGG - Intronic
1042932368 8:74026279-74026301 TCTGTGCTCCACAGCTTGTGTGG + Intronic
1060789109 9:126473866-126473888 CCTGTTCACCACCTTGTGTATGG + Intronic
1061995561 9:134181093-134181115 CCTGTTCTTCACAGTGGGGACGG + Intergenic
1062244268 9:135556086-135556108 ACTCTTCTCCTCAGCGTGTGTGG + Intergenic
1190037389 X:47038433-47038455 CCTTTTCTCCACAGTGTTTGAGG + Intronic
1200735559 Y:6790110-6790132 ATTATTCTCCACAGCATGTATGG - Intergenic