ID: 1078010485

View in Genome Browser
Species Human (GRCh38)
Location 11:7569687-7569709
Sequence CAGTGTTACCCTCAGGAGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 161
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 145}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078010482_1078010485 -6 Left 1078010482 11:7569670-7569692 CCTGTGGTGCAGCAGAGCAGTGT 0: 1
1: 0
2: 2
3: 15
4: 179
Right 1078010485 11:7569687-7569709 CAGTGTTACCCTCAGGAGATGGG 0: 1
1: 0
2: 0
3: 15
4: 145
1078010478_1078010485 26 Left 1078010478 11:7569638-7569660 CCTGCAGAGGAAGCATCAGGGAG 0: 1
1: 0
2: 2
3: 42
4: 403
Right 1078010485 11:7569687-7569709 CAGTGTTACCCTCAGGAGATGGG 0: 1
1: 0
2: 0
3: 15
4: 145
1078010481_1078010485 -2 Left 1078010481 11:7569666-7569688 CCTGCCTGTGGTGCAGCAGAGCA 0: 1
1: 0
2: 4
3: 66
4: 954
Right 1078010485 11:7569687-7569709 CAGTGTTACCCTCAGGAGATGGG 0: 1
1: 0
2: 0
3: 15
4: 145

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078010485 Original CRISPR CAGTGTTACCCTCAGGAGAT GGG Intronic
901007350 1:6178543-6178565 CAGAGTTCCCCTCCGGAGAATGG + Intronic
902527789 1:17070524-17070546 CAGTGTTATCCTCAGCTCATGGG - Intronic
906407771 1:45555673-45555695 CCGTGGTATCCACAGGAGATTGG - Intronic
909846535 1:80400701-80400723 CAGTGTTACCCTATGGATAGGGG - Intergenic
910240375 1:85079820-85079842 CAGTATTGCTCTCAGGAGAGAGG - Intronic
912384486 1:109264415-109264437 CAGTGTTGCCCTCAGTGGAGCGG - Intronic
912550539 1:110482762-110482784 CAGAGGAACCCTGAGGAGATGGG - Intergenic
915454491 1:156030493-156030515 CAGTGTCACTCTCAGGATATGGG + Intergenic
916444065 1:164855797-164855819 GATTGTTTCCCTCAGGATATAGG - Intronic
916876960 1:168979536-168979558 CTGTCTCACGCTCAGGAGATTGG + Intergenic
917839900 1:178969383-178969405 CTGTGTTACGCTCAGGAGGTTGG + Intergenic
918043964 1:180929999-180930021 CATTGTGACCCTTAGGAGAGGGG + Intronic
918868785 1:189938485-189938507 CAATTTTACCCTCAAGAGTTAGG - Intergenic
919924980 1:202187532-202187554 CAGTGAGACTCACAGGAGATGGG - Intergenic
920339050 1:205264030-205264052 CAGTATTAACCTCACAAGATGGG - Intronic
924810362 1:247395773-247395795 CAGTGTTTGCCTCTGGAGAGAGG - Intergenic
1065944899 10:30597344-30597366 CAGTGTAACCAGCAGGAGTTGGG + Intergenic
1067355014 10:45516094-45516116 CATTGTGAGCCTCAGGTGATAGG - Intronic
1073064993 10:100753031-100753053 CTGTGTGCCCCTCAGGTGATAGG - Intronic
1075894343 10:125981761-125981783 CAGTGTCACAGTCAGGATATTGG + Intronic
1078010485 11:7569687-7569709 CAGTGTTACCCTCAGGAGATGGG + Intronic
1078061276 11:8046476-8046498 CTGGGTTTCCCCCAGGAGATAGG - Intronic
1078382411 11:10856670-10856692 CATTGTTTACCTGAGGAGATTGG - Intronic
1078423282 11:11229533-11229555 CAGTGATACGCTGAAGAGATTGG + Intergenic
1079214031 11:18490277-18490299 CAGTGTTACTCTGTGGACATCGG - Intronic
1079589667 11:22167073-22167095 CTGTGTTGACCTCAGGTGATAGG - Intergenic
1079818022 11:25087276-25087298 CAGTGCTTCCATCAGTAGATTGG + Intergenic
1081998148 11:47377745-47377767 CAGGGGTACCCACAGGAGACAGG - Intronic
1082881202 11:58040151-58040173 CAGTGATACCCTGAGTAAATTGG + Intronic
1083731922 11:64656937-64656959 TAGTGCTAGCCTCAAGAGATGGG - Intronic
1088662456 11:112061234-112061256 CTGTGGTATCCTCAGGGGATTGG + Intronic
1089964024 11:122640601-122640623 CAGTGTTACTCTAAGTAGAAAGG + Intergenic
1091099508 11:132857924-132857946 AAGTGTTACCCTGGGGAGACAGG + Intronic
1091321469 11:134655346-134655368 CAGTGCTACCCCCAGATGATGGG + Intergenic
1091487279 12:901775-901797 TACTGTTACCCTCAGAAGTTTGG + Intronic
1091951295 12:4595311-4595333 TAGTGTTACACTCATGAGTTTGG - Intronic
1092184039 12:6465602-6465624 AAGTGATACCCTGAGGAGTTTGG - Intronic
1094234515 12:28148365-28148387 CTGTGTTTCCCTCAGGGGTTTGG - Intronic
1094423343 12:30295310-30295332 CAGCGTTACCTTCAGCAGTTGGG - Intergenic
1105301579 13:19140361-19140383 CAGAGATAACCTCAGGAGTTTGG - Intergenic
1106190623 13:27449597-27449619 CAGTGTTAAGCTCAGTAAATTGG - Intronic
1107108293 13:36670292-36670314 CAATGTCACCCTGAGGAGGTAGG + Intergenic
1112490664 13:99860453-99860475 CAGGGTTACCCTCAGAAGCTGGG + Intronic
1119593000 14:75907834-75907856 CAGTATTTCCCTTAGGAGACTGG + Intronic
1122852634 14:104545325-104545347 CAGTGAGACCCTCCTGAGATGGG - Intronic
1126260955 15:46690566-46690588 AAGTTTTACCCTCAAGATATTGG + Intergenic
1127002310 15:54523750-54523772 CAGTATTTCCTTCAGGAAATGGG - Intronic
1131307298 15:91256586-91256608 TAGTGTTACTCCCAGGAGAAAGG + Intronic
1131874907 15:96795067-96795089 TATTGTTAGACTCAGGAGATAGG - Intergenic
1137660766 16:50204103-50204125 CAGTGTTACCATAAGGAGGTTGG + Intronic
1139239442 16:65375769-65375791 CAGTGTCAGGCTCAGCAGATAGG + Intergenic
1141577184 16:84971539-84971561 CAGTCTTCCAGTCAGGAGATGGG + Intergenic
1142289278 16:89185379-89185401 CAGAGGGACCCGCAGGAGATGGG - Intronic
1143513181 17:7406825-7406847 CAGTGTTGCCCCCAGGACATGGG + Intronic
1144033553 17:11343193-11343215 CAGTGTTAGCCTCTGGAGGAAGG + Intronic
1144648050 17:16988646-16988668 TAGTTTTACCCTAAGGAGGTAGG - Intergenic
1148616399 17:49003868-49003890 CAGTGTTACCCACGGGAGAGGGG + Intronic
1149537443 17:57443556-57443578 CAGTGCTCCCCTCTGCAGATGGG - Intronic
1150314256 17:64155536-64155558 TTCTGTGACCCTCAGGAGATAGG - Intronic
1154300054 18:13184760-13184782 CAGGCTTGCCCTCAGGAGACAGG - Intergenic
1154357889 18:13636175-13636197 CCTTGGTACCCTCAGGGGATTGG + Intronic
1157608456 18:48940834-48940856 CTGTGAAGCCCTCAGGAGATGGG - Intronic
1158104801 18:53873621-53873643 CAGTGTCTGGCTCAGGAGATAGG - Intergenic
1158911396 18:62066333-62066355 CACTGTGGCCCTAAGGAGATTGG - Intronic
1159330601 18:66990098-66990120 CAGTGTAATGCTCAGGAGATGGG + Intergenic
1159392593 18:67812630-67812652 CAGTGTCGGCCACAGGAGATGGG - Intergenic
1159678021 18:71310476-71310498 CAGTATTTCCCTCAAGACATTGG + Intergenic
1164736201 19:30543340-30543362 GAGTGGTCCCCTCAGTAGATGGG + Intronic
1167982261 19:53284740-53284762 CAGTGTCACCTTCATGAGAGGGG + Intergenic
1167983884 19:53299233-53299255 CAGTGTCACCTTCATGAGAGGGG - Intergenic
928730944 2:34231523-34231545 CACTGTTTCCATCAAGAGATGGG + Intergenic
931442013 2:62296715-62296737 CAGTGTTATCCTCAGCAAAGAGG + Intergenic
936261238 2:110961068-110961090 CCTTGTTACTTTCAGGAGATGGG + Intronic
937036332 2:118785729-118785751 CAATGTCACCCTCAGGACTTAGG - Intergenic
938409086 2:131048952-131048974 CAGTGTTACTCTGAGCAGTTGGG - Exonic
943524876 2:189004032-189004054 CAGTGTTACCCGCAGGACCTGGG - Exonic
946411525 2:219517511-219517533 CAGAGTTACACTCAGCAGACGGG - Intronic
946904270 2:224401343-224401365 CAGCGTCACCCTCAGGATCTCGG + Exonic
1169186058 20:3618166-3618188 CACTGTCACCCTCAGGATAATGG + Intronic
1169690556 20:8326338-8326360 CAATCTTACACTCAGGACATGGG - Intronic
1170466159 20:16624185-16624207 CAGTGTCACCCTCAGCTGCTAGG + Intergenic
1171412212 20:24955268-24955290 CAGTGTTACCATCAGGAAGGAGG - Intronic
1173090083 20:39962141-39962163 CACTGTTACTCTCAGAAAATTGG + Intergenic
1173307657 20:41865311-41865333 CAGTGCTGCCCTCAGGACAGTGG - Intergenic
1174062295 20:47841316-47841338 CAGCCTGACACTCAGGAGATGGG - Intergenic
1174073381 20:47914530-47914552 CAGCCTGACACTCAGGAGATGGG + Intergenic
1174162102 20:48558736-48558758 CAGAGTCACCCTCATGGGATTGG - Intergenic
1174863658 20:54115112-54115134 CAAATTCACCCTCAGGAGATGGG - Intergenic
1176079095 20:63262733-63262755 CTGAGTGACCCTCAGGAGACGGG + Intronic
1176079103 20:63262768-63262790 CTGAGTGACCCTCAGGAGACGGG + Intronic
1176079113 20:63262803-63262825 CTGAGTGACCCTCAGGAGACGGG + Intronic
1177931149 21:27285679-27285701 CAGTGTTTAACTCATGAGATTGG - Intergenic
1178407342 21:32335439-32335461 GTCTGTTACCCTCAGCAGATGGG + Intronic
1181669064 22:24417539-24417561 CAGAGCTACCCCCAGGAGAGCGG + Exonic
1182314263 22:29433456-29433478 CAGTTTTCCCAGCAGGAGATGGG - Intergenic
1184161257 22:42698615-42698637 CTGTGTTCCCGTCAGGACATCGG - Intronic
1184813814 22:46855405-46855427 CAGTGATACCACCAGGAGTTAGG + Intronic
949438315 3:4052689-4052711 TCGTGATACCCTCAAGAGATAGG + Intronic
949759935 3:7459214-7459236 CAGTGTTGCTCACAGGAGATCGG + Intronic
949893894 3:8754757-8754779 CAGAATTACCCTCTGGAGGTAGG + Intronic
956547279 3:70418623-70418645 CTCTGTCACCCTCAGGAGATGGG + Intergenic
956772331 3:72537138-72537160 CCGTGTTTCTCTCAGGAGACGGG - Intergenic
961046774 3:123714133-123714155 CAGTGTTACCCTCAACATCTCGG + Intronic
961803021 3:129467313-129467335 CAGTGATTTCCTCAGGGGATGGG - Intronic
962309853 3:134317724-134317746 CAGTGTTCTCCCCAGGGGATGGG - Intergenic
969412968 4:7042010-7042032 CAGTGGTACCACCAGGAGCTGGG - Exonic
971835969 4:31762955-31762977 CAGGGTTACCTTCGGGAGAGTGG + Intergenic
974183627 4:58416447-58416469 CAGTGTTACACTGAGGATACAGG + Intergenic
977890673 4:102307998-102308020 CAGTGTGAGCCTCAGGACAAAGG + Intronic
979124105 4:116945542-116945564 CATTATTACCCTCGAGAGATCGG - Intergenic
982928043 4:161364846-161364868 CAGTGTAAGCCTCAAGTGATGGG - Intergenic
984733503 4:183089513-183089535 CAGTGGCAGCCTCAGGAGATTGG + Intergenic
987197431 5:15540884-15540906 AAGTGATACTATCAGGAGATGGG - Intronic
989626441 5:43433768-43433790 CAGTGGTCACCTCAGGAGTTCGG - Intergenic
992461528 5:76965229-76965251 CTTTGGTATCCTCAGGAGATTGG - Intronic
997608182 5:135191633-135191655 CAGAGATACCCTCAGCAGGTCGG - Intronic
997733115 5:136194811-136194833 CAGTGGGCCACTCAGGAGATGGG + Intergenic
1002097047 5:176837541-176837563 CAGGGTCACCATCAGGAAATAGG + Intronic
1003135227 6:3430086-3430108 AAGTGTTATCTTCAGGAAATGGG + Intronic
1005516884 6:26563604-26563626 CAGAGTAACCCTAATGAGATAGG - Intergenic
1007165582 6:39826499-39826521 CAGTGGAATCCTCAGGTGATCGG + Intronic
1011664618 6:89622302-89622324 CAGTGCTACCCGCAGGACATGGG - Intronic
1013881779 6:114912579-114912601 AATTGTTTCCCTCAGGGGATGGG - Intergenic
1016617470 6:146068487-146068509 TAGTTTTACCCTCAGGAGAATGG - Intronic
1016835301 6:148470848-148470870 CAGTGTTACTCTCAGAAGTGTGG - Intronic
1017648011 6:156556753-156556775 TAGTGTCCCCCTCAGGAAATGGG + Intergenic
1021713309 7:23438078-23438100 TAGTGTTTCCTCCAGGAGATTGG - Intronic
1023361245 7:39417696-39417718 CTCTGTTACTCTAAGGAGATTGG - Intronic
1023473787 7:40554558-40554580 CATTCTTACCCTCAAGACATTGG - Intronic
1031327677 7:120422376-120422398 CACAGTTATCCTCAGGAGATTGG + Intronic
1034242668 7:149622308-149622330 CATTTTTACCTTGAGGAGATGGG - Intergenic
1034617088 7:152427682-152427704 CTTTGTTGCCCTTAGGAGATAGG - Intronic
1037785120 8:21898189-21898211 CACTGTCAGCCTCAGGAGTTTGG - Intergenic
1040467013 8:47704801-47704823 CAGTGTCCGGCTCAGGAGATAGG + Intronic
1042194881 8:66223415-66223437 CAGTGTCAACTGCAGGAGATGGG + Intergenic
1044974824 8:97654033-97654055 CAGGGTTACCTTTATGAGATGGG - Intronic
1045244106 8:100428094-100428116 CAGGGTGAGCCTCAGGAAATGGG - Intergenic
1047034116 8:120915795-120915817 CTGTGTTGCCTTCAGCAGATTGG + Intergenic
1047040617 8:120990638-120990660 CTGAGTTACCTTCAGGAGAAGGG - Intergenic
1048500893 8:134974213-134974235 CAGAGTGACCCTCAGAAGAGGGG - Intergenic
1049001514 8:139828220-139828242 CAGTGTGACCCTCAGCAGACAGG - Intronic
1049325246 8:142018151-142018173 TACTATGACCCTCAGGAGATGGG - Intergenic
1049622323 8:143604258-143604280 CAGGGTCAGCCTAAGGAGATGGG - Exonic
1050123631 9:2333971-2333993 CAGTGTCACCATCTGTAGATGGG + Intergenic
1050594890 9:7195348-7195370 AAGTGTTAAGCTCATGAGATGGG + Intergenic
1051522723 9:18008180-18008202 CTGTGTGACCCTCAGAAAATAGG + Intergenic
1052004141 9:23325849-23325871 CAGTGTTACCCTCATTAACTAGG + Intergenic
1055003807 9:71483357-71483379 CAGTGTGATACTCAGCAGATTGG - Intergenic
1061326494 9:129867811-129867833 CACTGTTATCCTCAGAAGAATGG + Intronic
1186633048 X:11371196-11371218 AAGTGTTTCCCTCACCAGATTGG + Intronic
1188433854 X:30138410-30138432 CAGTGTTACCCTCTAGTGAATGG + Intergenic
1190797930 X:53761147-53761169 CAGTGTTTCCCTCACCGGATTGG + Intergenic
1190917229 X:54820063-54820085 CAGTGTTTCCCTCACCGGATTGG - Intergenic
1194184686 X:90760659-90760681 CAGTGTTCACCACAGGAGAAAGG + Intergenic
1194202280 X:90967592-90967614 CAGTGGTAGCCACAGGGGATTGG - Intergenic
1194816337 X:98446466-98446488 AAGTTTTACCCTCAGGAAACTGG + Intergenic
1195640484 X:107169413-107169435 CACTGTTACCTTAAGGAAATTGG - Intronic
1197884673 X:131205776-131205798 CTGTGTTACCCTCATAAGAGAGG + Intergenic
1200531287 Y:4342662-4342684 CAGTGTTCACCCCAGGAGAAAGG + Intergenic
1200548116 Y:4543046-4543068 CAGTGGTAGCCACAGGGGATTGG - Intergenic
1200749253 Y:6929618-6929640 TAGTGTTCCCATCAGGAGCTGGG - Intronic