ID: 1078011084

View in Genome Browser
Species Human (GRCh38)
Location 11:7573710-7573732
Sequence CACAGTGGGCCCGCTGAGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 147
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 136}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078011084_1078011088 -5 Left 1078011084 11:7573710-7573732 CCCTTCTCAGCGGGCCCACTGTG 0: 1
1: 0
2: 0
3: 10
4: 136
Right 1078011088 11:7573728-7573750 CTGTGCACCATGTCTGTTGAAGG 0: 1
1: 0
2: 3
3: 17
4: 141
1078011084_1078011090 22 Left 1078011084 11:7573710-7573732 CCCTTCTCAGCGGGCCCACTGTG 0: 1
1: 0
2: 0
3: 10
4: 136
Right 1078011090 11:7573755-7573777 AAGTTTACATCTGACTTATGAGG 0: 1
1: 0
2: 1
3: 12
4: 140

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078011084 Original CRISPR CACAGTGGGCCCGCTGAGAA GGG (reversed) Intronic
900265397 1:1754599-1754621 CACAATGGGCTGGGTGAGAACGG - Exonic
901016611 1:6235624-6235646 CACTGCGGGCCCGGGGAGAAAGG + Intronic
901259689 1:7862261-7862283 CACAGTGGGCCTGCTGGGCCAGG + Intergenic
901500887 1:9652042-9652064 CCCCGTGGGCCCGCCGAGAGGGG + Intronic
905887275 1:41498098-41498120 CACAGGGGGCCAGCTGAGGCTGG - Intergenic
906035515 1:42748140-42748162 CACTGTGGGGCCTCTGAGGAGGG + Intronic
906320755 1:44813867-44813889 CTCACTGGGCACGCTGGGAACGG - Exonic
906512520 1:46418691-46418713 GGCAGTGGACCCGGTGAGAAGGG - Intergenic
906685114 1:47758231-47758253 CACAGCGGGCCAGCTGAGCTGGG + Intergenic
906728170 1:48059048-48059070 CTCAGTGTCCCAGCTGAGAAGGG - Intergenic
907516147 1:54994663-54994685 CAAAGTGGCCTCGCTGTGAATGG + Intergenic
917234315 1:172873987-172874009 CAAAGTGGCCCAGCAGAGAAGGG - Intergenic
918731015 1:187996212-187996234 CACAGGAGGCCTGCTGAAAATGG + Intergenic
919313741 1:195946071-195946093 CAAAGTGGGGCCTCTAAGAAAGG + Intergenic
922677094 1:227559831-227559853 CACATCGGGCCCGCTCAGGACGG - Intergenic
923018476 1:230145196-230145218 CACAGGGGGCGATCTGAGAATGG - Intronic
1067802162 10:49366369-49366391 CACAGTGGGCCCCCTGGAAAAGG + Exonic
1074632649 10:115275247-115275269 CCCAGTGGGCCCACTGTGAGAGG + Intronic
1075908485 10:126103656-126103678 CACAGTGGGCCGTCTTGGAAGGG - Intronic
1076872269 10:133199912-133199934 CACACTGGTCCCTCTGAGCAGGG - Intronic
1077194814 11:1274047-1274069 CCCAGTGGGCTCTCTCAGAACGG + Intergenic
1077241633 11:1513525-1513547 CGCAGTCGGCCTGCTGGGAAGGG + Intergenic
1077872260 11:6271823-6271845 CACAGTGGGAACTCTGACAAGGG + Exonic
1078011084 11:7573710-7573732 CACAGTGGGCCCGCTGAGAAGGG - Intronic
1081353764 11:42088220-42088242 CACATTTGGCCCCCTGAAAATGG + Intergenic
1084094830 11:66904224-66904246 CACAGTGAGTCACCTGAGAAGGG - Intronic
1085328429 11:75626643-75626665 CACAGTGGGCCCTCAGTAAAGGG - Intronic
1086306500 11:85486047-85486069 CACAGTGCGCCATCTGAGAGGGG + Intronic
1089730561 11:120516339-120516361 CACAGTGAGGAGGCTGAGAAGGG + Intronic
1090470926 11:126980442-126980464 GCCAGTGGGCTTGCTGAGAAGGG + Intronic
1090643686 11:128750181-128750203 CGGAGTGGGCCCACTGAGCAGGG + Intronic
1091218254 11:133916672-133916694 CACAGTGGGGACACTGGGAAAGG + Intronic
1092396742 12:8133922-8133944 GACACTGGTCCCCCTGAGAAAGG + Intronic
1092507084 12:9113490-9113512 CACACTGAGACCACTGAGAAGGG - Exonic
1093163161 12:15773014-15773036 CACAGTGGGCTCGCTGATGTAGG + Intronic
1096468722 12:51863528-51863550 CTCCGTGGACCCGCTGGGAAAGG + Intergenic
1097198005 12:57254942-57254964 AACAGTGGGACTGCTGAGAATGG - Exonic
1098602464 12:72347957-72347979 CACTGGGGGCCCGCTTAGAAAGG + Intronic
1099079886 12:78164022-78164044 CACAGAAGGCCAGTTGAGAAAGG + Intronic
1111730061 13:92063426-92063448 CACTCTGGGCCTACTGAGAATGG + Intronic
1115242334 14:31261920-31261942 CACAGTGGGTGCCCAGAGAATGG + Intergenic
1115465558 14:33710638-33710660 GACAGTGGGTCCCCGGAGAAAGG + Intronic
1118314776 14:64719353-64719375 CACAGTAAGCCCACCGAGAATGG - Intronic
1118817721 14:69324682-69324704 CACAGATGGGCAGCTGAGAAGGG - Exonic
1121308901 14:92924121-92924143 CCCAGTGAGCCCGGTCAGAAAGG + Intronic
1122400550 14:101464899-101464921 CCCAGTGGACCCGCTGAGCCAGG + Intergenic
1124251219 15:28107427-28107449 CAGCGCGGGTCCGCTGAGAATGG + Intergenic
1125117210 15:36108696-36108718 CACAGGGGACCAGCTGAGCATGG + Intergenic
1128528463 15:68428453-68428475 CACAGTGGACCCCCAGAGAGGGG - Intronic
1128863225 15:71092282-71092304 CAGAGTGGCGCCGCTGAGAGGGG - Intergenic
1132057428 15:98662944-98662966 TGCAGTGGACCCGCTGAGAAGGG + Intronic
1134610175 16:15601670-15601692 GGCAGTGGGCGCGCTGAGGAGGG - Intronic
1140485476 16:75289964-75289986 CTCGGTGGGTCCACTGAGAAAGG + Intergenic
1141164811 16:81653307-81653329 CAGTGTGGGCCTGCAGAGAAAGG - Intronic
1142287884 16:89178865-89178887 CACAGTGGGCTGGCTGTGGAGGG - Intronic
1143134517 17:4704079-4704101 CGCAGAGGGCCCACTCAGAACGG + Exonic
1143336473 17:6175285-6175307 CAGAGAGGGCCCGCTGGGAGTGG - Intergenic
1143378626 17:6481651-6481673 CACTGTGGGCTCTCTGAGAAAGG - Intronic
1144763223 17:17719055-17719077 CAGGGTGGGGCCGATGAGAAGGG - Intronic
1144931755 17:18864741-18864763 TGCAGTGGGCTTGCTGAGAAAGG + Intronic
1146257541 17:31400375-31400397 CACAGTGAGCCCGAAGACAAGGG + Intronic
1148132891 17:45273111-45273133 CACAGTGGGCAGGCTGACCAAGG - Intronic
1148814329 17:50315941-50315963 CACAGTGAGCCTGCAGAGACAGG + Intergenic
1153615581 18:6930063-6930085 CAGAGTAGACCCGCTGCGAAGGG - Intergenic
1157451906 18:47795341-47795363 GACAGTGGCCCCTCTCAGAACGG + Intergenic
1159995269 18:74958407-74958429 CACAGTGGGCCTGTCGAGGAGGG + Intronic
1160740321 19:682598-682620 CCCAGTGTGCCCCCTGGGAAAGG + Exonic
1161280072 19:3441283-3441305 CTGAGTGGGGCCGCTGGGAACGG - Intronic
1162585175 19:11553932-11553954 CACAGTGGGCCAGATGAGCAGGG + Intronic
1165929124 19:39344655-39344677 AAAAGGGGGCCCCCTGAGAAAGG - Intronic
1167167008 19:47805126-47805148 CACATTGGCCCTGCTGATAATGG + Intronic
1167597746 19:50436272-50436294 GAGAGTGGGCCCTCTGAGGATGG + Intronic
926220833 2:10934606-10934628 CACAGTCGGCCAGCTGGAAAGGG - Intergenic
929827021 2:45316771-45316793 CACAGTGGTCCAGCTGCGGAGGG - Intergenic
936443920 2:112581176-112581198 CACAGTGGTCCCCAAGAGAAAGG - Intergenic
937023362 2:118678428-118678450 CCCAGTGGATCCTCTGAGAAAGG + Intergenic
937231233 2:120399192-120399214 CACAGTGGGGCCCATGAGGATGG - Intergenic
937285127 2:120745916-120745938 CACTGGGGGCCCCGTGAGAAGGG + Intronic
937909918 2:127070506-127070528 ACCAGAGGGCCCTCTGAGAAGGG + Intronic
946058447 2:216920753-216920775 CACAGTGAGCCACCAGAGAAAGG - Intergenic
948465310 2:238149242-238149264 CACAGAGGGCCCACTGCGAAGGG + Intronic
948465323 2:238149286-238149308 CACAGAGGGCCCACAGTGAAGGG + Intronic
948982057 2:241499463-241499485 CACCCCGGGCCCCCTGAGAAGGG + Intronic
1169255273 20:4092042-4092064 TCTCGTGGGCCCGCTGAGAACGG + Intergenic
1169299571 20:4430528-4430550 CACAGTGGGGCAGAGGAGAAGGG + Intergenic
1169861652 20:10159204-10159226 CACAGAGGGTGCGCTGAGCAGGG + Intergenic
1172614177 20:36272770-36272792 CACTCTGGGCCTGCTGGGAACGG + Intergenic
1173676931 20:44844047-44844069 CACAGTAGGGTTGCTGAGAAGGG - Intergenic
1178225197 21:30708625-30708647 CACAGAGGTCCCACTGAGGATGG - Intergenic
1179627214 21:42655468-42655490 CACAGTGGACACGCTGAGGTTGG + Intronic
1182075583 22:27493267-27493289 CACAGTGGTGCCACTGAGATGGG + Intergenic
1182414210 22:30210562-30210584 CCCAGTTGGCCCGGTGAGTAAGG - Intergenic
1182520614 22:30882564-30882586 CACAGTGGGCCCGCGGTGTGAGG + Intronic
1182860866 22:33558179-33558201 CACACTGGGCCAGCCAAGAAGGG + Intronic
1183095944 22:35552405-35552427 CACAGAAGGCCAGATGAGAAAGG + Exonic
1183553455 22:38506825-38506847 CGCCCTGGGCCCGCTGAGAATGG + Intronic
1184198645 22:42949383-42949405 CTCAGTGGCACAGCTGAGAATGG - Intronic
949332391 3:2936752-2936774 TACAGTTGGCAAGCTGAGAATGG + Intronic
949508198 3:4746025-4746047 CAGAGTGGCCCAGCTGGGAATGG + Intronic
950640740 3:14346611-14346633 CACAGTGGGTCCACTCAGAGTGG - Intergenic
950649927 3:14401063-14401085 CACCCGGGGCCCGCAGAGAAGGG + Intergenic
955516392 3:59730456-59730478 CTCAGTGGGCCCGCAGGGAAGGG - Intergenic
961680352 3:128595856-128595878 CTCAGTGGGACCACTGGGAAGGG + Intergenic
969239239 4:5888343-5888365 CCCAGCGGGCGCGCTGACAAAGG + Intronic
978523960 4:109645701-109645723 CACAGTGGGTACACTGAGCAGGG - Intronic
982081207 4:151792213-151792235 CACAGTGGGGCACCTGGGAAGGG - Intergenic
983630938 4:169848588-169848610 CACAGTGGGAGCCCTGAGAGGGG - Intergenic
988832852 5:35004328-35004350 CGCAGTGGGACAGCTGAGGAGGG + Intronic
989133865 5:38134089-38134111 CACAGCTGGCCCCATGAGAAGGG - Intergenic
992377259 5:76200160-76200182 CACAGTGGGCCCAGTGAGTCAGG + Intronic
1002942481 6:1730394-1730416 AACAGTGGGAGAGCTGAGAATGG + Intronic
1004058935 6:12171508-12171530 CACAGTGGCCCCTGTGAGAGGGG + Intergenic
1006028887 6:31164752-31164774 GACACTGGTCCCCCTGAGAAAGG + Exonic
1007318288 6:41007716-41007738 CTCAGAGGGGCCTCTGAGAAGGG - Intergenic
1007673525 6:43576155-43576177 GACAGCGCGCCCGCTGCGAAGGG - Exonic
1007924510 6:45640678-45640700 CACAGTGGCCCCACTGACGATGG + Intronic
1011475250 6:87745074-87745096 CACAGTGGGCCCTCAAACAATGG + Intergenic
1012836830 6:104280143-104280165 CACAGGGAGCCTGCAGAGAAGGG - Intergenic
1013615176 6:111836177-111836199 CACAGTAGGCCTTCAGAGAAAGG + Intronic
1013761647 6:113525410-113525432 CACAGTGTCCAGGCTGAGAAAGG + Intergenic
1014286500 6:119504619-119504641 CACTTTGGGCCAGGTGAGAAAGG - Intergenic
1015808320 6:137134257-137134279 CTTAGTGTGCCAGCTGAGAAGGG - Intergenic
1016987240 6:149904772-149904794 GAGAGTGGGCCAGCTGTGAAAGG + Intergenic
1018221969 6:161590250-161590272 CACTGTGTGCCTACTGAGAAGGG + Intronic
1019726277 7:2604632-2604654 CACAGTGGGGACTCTGGGAATGG - Intronic
1021315556 7:19144220-19144242 CAAAGTGCGACCTCTGAGAAGGG - Intergenic
1022113930 7:27246803-27246825 GAGAGGGGGCCCGGTGAGAAGGG - Intronic
1023603154 7:41900646-41900668 CACAGTGGGCTGGATGAGGAAGG + Intergenic
1024027353 7:45424049-45424071 CACAGTGGGGCAGCAGAGAGGGG - Intergenic
1026115929 7:67495689-67495711 CACAGTGGGTAGGTTGAGAAGGG + Intergenic
1031359337 7:120828508-120828530 GACAGTGGGCCAGAGGAGAAAGG - Intronic
1031640827 7:124161716-124161738 CAGAGTGTGCACTCTGAGAAAGG + Intergenic
1032026526 7:128446820-128446842 CACAGTGGGCTCTATGAGCATGG - Intergenic
1034886969 7:154805589-154805611 CACAGTTGGGCTGTTGAGAAGGG - Intronic
1047697394 8:127416773-127416795 GACACTGGTCCCCCTGAGAAAGG - Exonic
1049288611 8:141790135-141790157 CGCAGTGGTCCCGCTGAGGAAGG - Intergenic
1049494144 8:142921902-142921924 GACAGTGGGGACCCTGAGAACGG - Intergenic
1050274882 9:3986404-3986426 CACAGTGGGGGTGGTGAGAAGGG - Intronic
1053268341 9:36732456-36732478 CACAGTAGAACCACTGAGAAGGG - Intergenic
1057269678 9:93643816-93643838 CACCGTGGGCCCTCTGTAAATGG + Intronic
1057390531 9:94638819-94638841 CACACTTGGCCGGCTGAGAGGGG + Intronic
1058066522 9:100554575-100554597 CACAGTGGGCAGGCTAGGAAAGG + Intronic
1060766604 9:126298659-126298681 CGCAGTGGGCCCGGAGAGCAGGG - Intergenic
1062548016 9:137072385-137072407 CACAGTGGGTGCTCTGTGAATGG + Intergenic
1062633964 9:137480302-137480324 CACAGTGGGCGAGGTGAGCACGG - Exonic
1195708895 X:107758560-107758582 AACAGTGGGCCTGGTGAGAGTGG + Intronic
1198017067 X:132622040-132622062 CACAGAGGGCCCTCGGGGAATGG - Intergenic