ID: 1078011721

View in Genome Browser
Species Human (GRCh38)
Location 11:7577477-7577499
Sequence TTGGAGTTCTTGAGGGGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 286
Summary {0: 1, 1: 1, 2: 1, 3: 27, 4: 256}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078011713_1078011721 6 Left 1078011713 11:7577448-7577470 CCAGGGAAGTGGGGAAATTTGAA 0: 1
1: 0
2: 1
3: 32
4: 297
Right 1078011721 11:7577477-7577499 TTGGAGTTCTTGAGGGGGGAGGG 0: 1
1: 1
2: 1
3: 27
4: 256

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078011721 Original CRISPR TTGGAGTTCTTGAGGGGGGA GGG Intronic
900297028 1:1957088-1957110 TTGGAGGTCCTGAGGATGGATGG + Intronic
901558208 1:10048362-10048384 TTGCAGTTCTTGGGGGAGGTTGG + Intronic
905878057 1:41445979-41446001 TTGGGGATCTTGAAGGGGGAAGG - Intergenic
908600108 1:65729572-65729594 CCTGAGTACTTGAGGGGGGAAGG - Intergenic
912738956 1:112175660-112175682 TGGGACTTCTTGAAGGGTGAAGG - Intergenic
913164053 1:116168976-116168998 GTGGAGTAGTGGAGGGGGGACGG - Intergenic
913653291 1:120938567-120938589 TTGGAGTTCTTAGGGGGTGGTGG - Intergenic
914167814 1:145190476-145190498 TTGGAGTTCTTAGGGGGTGGTGG + Intergenic
914518979 1:148398679-148398701 TTGGAGTTCTTAGGGGGTGGTGG - Intergenic
914643472 1:149632718-149632740 TTGGAGTTCTTAGGGGGTGGTGG - Intergenic
916236379 1:162592871-162592893 TTGGGGGTCTGGAGGGAGGATGG + Intronic
918005103 1:180534583-180534605 TTTGAGTTCCTGAGGTGGGGAGG + Intergenic
923836734 1:237618966-237618988 TTGGACATCTGGAGGAGGGAAGG - Intronic
923853164 1:237819058-237819080 TTGGAGTTCGTGCTGGAGGAGGG + Exonic
1062908152 10:1193053-1193075 GTGGAGGTGTTGAGGGTGGAAGG + Intronic
1063960957 10:11305125-11305147 TTGGATTTCCTGTGGGAGGAGGG - Intronic
1064737776 10:18400563-18400585 TTGGAGATCTCGAGGGGGAGGGG - Intronic
1064828965 10:19440485-19440507 GTGGGGTTGTTGCGGGGGGAGGG - Intronic
1065471015 10:26081410-26081432 TCGGAGTTGTTGCGGGGGCATGG - Intronic
1068784872 10:60960957-60960979 TTGGGGTTCGTGGGGGTGGAGGG + Intronic
1071953001 10:90726552-90726574 TTGCAGTTATTGAGTGGTGAAGG + Intergenic
1073037765 10:100576135-100576157 TTGAAGGTCTTGTGGGGGGTGGG - Intergenic
1075471602 10:122694869-122694891 TTGGAGTTGGTGGGGGGGGGAGG - Intergenic
1076149995 10:128154110-128154132 TTGGAGTTCTTCCTGGGGAAAGG - Intergenic
1076576311 10:131472039-131472061 TTGAAGTTCTTGGTGGGGGAAGG + Intergenic
1077643731 11:3904865-3904887 TTGGAGTTCCTGAGAGAGGTAGG + Intronic
1078011721 11:7577477-7577499 TTGGAGTTCTTGAGGGGGGAGGG + Intronic
1079004469 11:16782344-16782366 TTGGATTTCTTGCTGGGGCAAGG - Intronic
1080708248 11:34719952-34719974 GTGAAGTTCTTGAGTGGTGAGGG + Intergenic
1082107828 11:48239923-48239945 AGGGACTACTTGAGGGGGGAGGG - Intergenic
1082712063 11:56565104-56565126 GGGGTCTTCTTGAGGGGGGAGGG - Intergenic
1083152047 11:60798085-60798107 TTGGGTTTCCTGAGGGGGGCTGG - Intronic
1083310412 11:61780903-61780925 TGGGAGAGCTTGAGGGGAGAGGG - Intronic
1084537060 11:69763536-69763558 TTGCAGTTCTGGAGGGCAGAAGG - Intergenic
1086685559 11:89730120-89730142 CTGGACTACTTGAGGGTGGAGGG + Intergenic
1088960702 11:114662021-114662043 TTGGTGTCCTTGCGGGGGGTAGG - Intergenic
1089194053 11:116681572-116681594 ATGGAGGTCTTCAGGAGGGATGG + Intergenic
1089335033 11:117717278-117717300 ATGGAATACTTGAGGGGGGCAGG - Intronic
1089413549 11:118267379-118267401 TTGGAGTTGTTGGTTGGGGAAGG - Intergenic
1089532265 11:119138051-119138073 TTGGATTTCTTGGCTGGGGAGGG + Intergenic
1090613429 11:128492720-128492742 TTGGAGGTGTAGAGTGGGGATGG - Intronic
1091216365 11:133904802-133904824 TTGGAGAACTGGAGGGTGGAGGG - Intergenic
1091387454 12:103842-103864 GTGGAGTTCATGAGGGGAGGCGG + Intronic
1092007332 12:5080461-5080483 TTGGAGTTCTGGGTGGGAGAAGG - Intergenic
1093912641 12:24764653-24764675 TGGGAGTTCTGGAGTTGGGATGG - Intergenic
1094092097 12:26661781-26661803 GTGGAGGTCTGGAGTGGGGAAGG - Intronic
1094205079 12:27831274-27831296 GTGGACTTCTTGAGGAGGTAAGG - Intergenic
1095679617 12:44958822-44958844 TTGGCGTGTTTGAGGGAGGAGGG + Intergenic
1096079964 12:48826745-48826767 CTGGAGTACCTGAGCGGGGAGGG - Exonic
1096490108 12:52008418-52008440 TGGGAGTTCTTTAGGGGTGGTGG - Intronic
1096531214 12:52243997-52244019 TTGGAGGTGTTGATGGGGGAAGG + Intronic
1096559404 12:52424830-52424852 CTGGAGTCCTTGGGTGGGGAGGG + Intronic
1096673527 12:53214228-53214250 CTGGAGTTCTGCAGAGGGGAGGG + Exonic
1100481859 12:94986819-94986841 TTGGAGGTTTTTAGAGGGGAGGG - Intronic
1100897244 12:99197357-99197379 CTGGAGTTCTTGGGAGGGAATGG - Intronic
1107002973 13:35572611-35572633 TTGGAAGTATTGAGGGTGGATGG - Intronic
1108677240 13:52747719-52747741 TTTGAGTTCTTGAGAGCGGAAGG - Intergenic
1108706299 13:52991548-52991570 TTGGGGTTTTTGAGAGGGAATGG + Intergenic
1110375843 13:74793206-74793228 TTGGTGTTCCTGAGGGAGAAGGG - Intergenic
1112054579 13:95677764-95677786 CTGGAGTTCTTGGGTGGGGAAGG + Intronic
1112386051 13:98940656-98940678 TTGGTGGTCTTGAGGTGGGGGGG + Intronic
1116392695 14:44412815-44412837 TTGGTGTTCTTGTGGGGGAGGGG - Intergenic
1118911456 14:70065355-70065377 TTGGAGTTCATGTGGTGGGGTGG - Intronic
1119930643 14:78542872-78542894 TTGGAGTGCTTGAGTTGGTAGGG + Intronic
1120993160 14:90396645-90396667 TTGGAGATGTTGAGGTGGGAGGG + Intronic
1121374062 14:93389533-93389555 TTGGAGTTCTTGGAGGTGGAAGG + Intronic
1121742424 14:96263693-96263715 TTGGAGCTCTAGAGGGGGCCAGG - Exonic
1122354838 14:101116632-101116654 TTGGAGTGCTTGGAGTGGGAAGG - Intergenic
1122763585 14:104048962-104048984 GTGGAGTTCTTGCTGGGGTAGGG - Intronic
1126049505 15:44673464-44673486 GTGAAGTTCTTGAGGGGAAAAGG - Intronic
1126175315 15:45730433-45730455 CTGGAGTTCTTTGAGGGGGATGG + Intergenic
1126572368 15:50165461-50165483 TTGGTGTTCCTGGTGGGGGATGG + Intronic
1126598476 15:50405165-50405187 GTGGAGTCCTTGAAGGAGGAAGG - Intergenic
1126710065 15:51445233-51445255 TTGGAGTCCGTGAGGGAGGAGGG - Intergenic
1127165921 15:56244463-56244485 CGGGAGTTCTTGCAGGGGGATGG - Intronic
1128276299 15:66356594-66356616 ATGAAGTTCTTGCGGGGAGAGGG - Intronic
1128540441 15:68525126-68525148 TTGGGGTTTTTTAGGGGGAATGG - Intergenic
1128718117 15:69925018-69925040 CTGGAGTTCTTGTTGGTGGACGG + Intergenic
1128869082 15:71138648-71138670 TTGGCCTTGTGGAGGGGGGAGGG - Intronic
1129939207 15:79479141-79479163 TTGTGGTTTTTGAGGGTGGAAGG + Intergenic
1131057441 15:89383974-89383996 CTGGAGTTTCTGAGGGGGAAAGG - Intergenic
1133920618 16:10149740-10149762 TAGGAGTTCTGGAGTGAGGAGGG - Intronic
1134294934 16:12937326-12937348 TTAGAGTGCTTGAGGAGAGAGGG - Intronic
1134399171 16:13893084-13893106 TTGGTGTTCTCGTGGGGGTATGG - Intergenic
1135020817 16:18961664-18961686 CTGGAGTTCTAGAGAGAGGATGG - Intergenic
1137492566 16:48945064-48945086 TGGGAGTTCTTAGGAGGGGAGGG + Intergenic
1137898880 16:52243679-52243701 TTGGAGTTCTGGCGTGGGGGTGG + Intergenic
1139620281 16:68134700-68134722 TTGGGGTTTTTTTGGGGGGATGG + Intronic
1139743699 16:69057588-69057610 TTGGAGTTCTTCAGGTGACAGGG - Intronic
1139912791 16:70408444-70408466 TTTGAGTTGTTGGGGAGGGAGGG - Intronic
1140615558 16:76658332-76658354 ATGGAATTCTAGAGTGGGGAGGG + Intergenic
1141812243 16:86383337-86383359 TTGGAGTTCCCGTGTGGGGAAGG - Intergenic
1143750844 17:9026379-9026401 TTGGATTTCTTCCGGGGGGGGGG + Intronic
1143887198 17:10073573-10073595 TAGGAGGTCTTGAGGGGAGCGGG - Intronic
1144903915 17:18624778-18624800 ATGAAGTTCTTAAGGGTGGAAGG + Intergenic
1145243284 17:21251983-21252005 TGGGACCTCCTGAGGGGGGATGG + Intronic
1145781364 17:27566071-27566093 TTGGAGTTCATGTGGGGGTGGGG + Intronic
1148553959 17:48566751-48566773 TTGGAGTTTTTGAGAGAGCAGGG - Intronic
1148604077 17:48915681-48915703 ATGGAGTTAGTGAGGGGAGAGGG - Intronic
1149111305 17:53033800-53033822 TTGGTGTTCCTGTGGGGGGTGGG + Intergenic
1149144074 17:53468769-53468791 TTGAAGATCTGGAGAGGGGAGGG + Intergenic
1149615212 17:57991645-57991667 TTGGAGTATTTAAGGGGGGATGG - Intronic
1149880617 17:60286763-60286785 TGGGAGTTCTTGGTGAGGGAGGG - Intronic
1152040793 17:77901358-77901380 TTGCAGTTCTGGAGGGTGGAAGG - Intergenic
1152231506 17:79116255-79116277 TTAAAATTCTTGAGGTGGGAAGG - Intronic
1153210404 18:2756480-2756502 CTGGTGTTTTTGTGGGGGGAAGG + Intronic
1156120526 18:33837167-33837189 TTGGAGATATTGAGTGGGGATGG - Intergenic
1160249380 18:77187988-77188010 ATGGATTTGTTGTGGGGGGAGGG - Intergenic
1161579307 19:5071948-5071970 TTGGGGTGCGTGAGGGGTGAGGG + Intronic
1162037035 19:7946240-7946262 ATGGAGGTCTCGAGGGGGCATGG - Intergenic
1162126874 19:8504207-8504229 TTGCAGTTCTGGAGGAGTGAGGG + Intergenic
1162593182 19:11606552-11606574 CTGGGGTTCTTGAGGACGGATGG + Intronic
1162625612 19:11882199-11882221 TTGGAGTTCTTTAGGGGAGAGGG - Intronic
1163808455 19:19415090-19415112 TTGGGGTTTTTTTGGGGGGAGGG - Intronic
1164513119 19:28913308-28913330 TTGGAGCTCTTGCAGGGGGTCGG - Intergenic
1164527575 19:29023093-29023115 CTGGAGGTTTTGAGGAGGGATGG + Intergenic
1164790353 19:30972298-30972320 TTGGAGTGGGTGAGGGAGGAGGG - Intergenic
1165423131 19:35732201-35732223 ATGGACTTCCTGTGGGGGGAGGG - Exonic
1165488932 19:36112199-36112221 TTGTTTTTTTTGAGGGGGGATGG - Intronic
1168387563 19:55978220-55978242 TTTAAGTTTTAGAGGGGGGAGGG + Intronic
926557232 2:14373280-14373302 AGGGAGTACTTGAGGGTGGAGGG + Intergenic
928366326 2:30706047-30706069 TCGGAGTCCTTGAGGGGTGGGGG + Intergenic
929088138 2:38188906-38188928 TTGGAGTTGGTGAGGAGAGATGG + Intergenic
929199522 2:39220340-39220362 TTGGAGACCTTGAGGGGAGGTGG - Intronic
930237606 2:48902958-48902980 TGGGAGTTTTTGAGTGGGAATGG + Intergenic
931783158 2:65597323-65597345 TTCTAGTTCTTGAGGTGGGTAGG + Intergenic
934188061 2:89763661-89763683 TTGGGGTTCTTGTGGGGGAGAGG + Intergenic
935184845 2:100722747-100722769 ATGGATTTCTGGAGGAGGGATGG - Intergenic
936133813 2:109871563-109871585 TGGGTGCTCTTGAGGGGAGAAGG - Intergenic
936210884 2:110499922-110499944 TGGGTGCTCTTGAGGGGAGAAGG + Intergenic
936435412 2:112501025-112501047 TGGGTGCTCTTGAGGGGAGAAGG + Intronic
937596035 2:123674596-123674618 TTGCAGTTTTGGAGGGTGGAAGG - Intergenic
944616579 2:201466094-201466116 TTGGTGTTCCTGAAGGGTGAGGG + Intronic
945323756 2:208458601-208458623 GGGGTGTACTTGAGGGGGGAAGG - Intronic
945952123 2:216049257-216049279 TTGGTGTTCCTGAGGAGGTAAGG - Exonic
946384402 2:219373795-219373817 TTGCAGCTCCTGAGAGGGGATGG + Exonic
946510232 2:220348132-220348154 TTGCAGTTGTTGAGGGAGCATGG + Intergenic
947184868 2:227445811-227445833 TTGGGGTTCTGGAGTGGTGACGG + Intergenic
948627164 2:239276277-239276299 TTGGAAGTGTTGAGGGGAGAAGG + Intronic
948884320 2:240875304-240875326 TTGGGGTTCTTGAGGCATGAAGG - Intronic
1169068051 20:2705617-2705639 TTGGATTTCCTGAGGTTGGAGGG - Exonic
1172487565 20:35307514-35307536 TTGGACCTCTAGAGGAGGGAGGG + Intronic
1175665483 20:60855130-60855152 TTGCAGTTTTGGAGGGGGAAGGG - Intergenic
1176516599 21:7789114-7789136 TTGGAGCCCTTGAGGGGGACTGG - Intergenic
1177419273 21:20835052-20835074 CTTGAGTACTTGAGGGTGGAAGG - Intergenic
1178650627 21:34419126-34419148 TTGGAGCCCTTGAGGGGGACTGG - Exonic
1180005818 21:45019989-45020011 GTGGAGCTCGTGAGGGCGGAGGG - Intergenic
1182443583 22:30377705-30377727 TGGGAGTTCCTGAGGGAGGCTGG + Intronic
1182771244 22:32797848-32797870 TTGGAGTTTTTGAGGCGAGAGGG + Intronic
1183310680 22:37107999-37108021 TTGGACTTCTGTAGGGAGGAAGG - Intronic
1184149940 22:42631977-42631999 TTGGAGTTCCTGGGCAGGGAAGG - Intronic
1184698313 22:46151470-46151492 TTGGGGTGCGTGAGGGGGCAGGG - Intronic
1185117905 22:48948647-48948669 TTGGAGCTGTTGAGGGGCGAAGG - Intergenic
949696745 3:6705515-6705537 ATGGCCTACTTGAGGGGGGAAGG + Intergenic
949880618 3:8657956-8657978 TTGGAGTTGTCGTGGGGAGAAGG - Intronic
950120140 3:10476348-10476370 TTTGAGTCCTTGTGGGGTGAGGG - Intronic
950279294 3:11692730-11692752 TTGGTTTTTTTGAGGGGGGGTGG + Intronic
951620932 3:24601758-24601780 ATCGGGTTCTTGAGGGGGGGGGG + Intergenic
954377695 3:50203750-50203772 TGGCAGTTCTTGAGGGGCCAGGG - Intergenic
955095737 3:55796067-55796089 TTGTGGTGGTTGAGGGGGGAGGG + Intronic
960965858 3:123104296-123104318 CTGGAGTTCTTCAGGGCAGAGGG + Intronic
961316684 3:126041257-126041279 TAGGAGTTATGGAGGGGGGGTGG + Intronic
961706517 3:128790890-128790912 TTGTTGTTTTTGAGGTGGGAAGG - Intronic
962747363 3:138406897-138406919 TTGGAGTTACAGAGGAGGGATGG - Intergenic
963252828 3:143118811-143118833 TTAGTGTTCTTGGGGAGGGAGGG + Intergenic
963670188 3:148241783-148241805 TTGGAGTCCTGGAAGGGGTAAGG + Intergenic
964075637 3:152688529-152688551 TTGGTGCTGTTGAGGGGGCATGG + Intergenic
964162919 3:153667641-153667663 TTGGAATTTTGGCGGGGGGAGGG - Intergenic
964612221 3:158627042-158627064 TTGGAGTTCTTTTGGGGAGGGGG + Intergenic
964750696 3:160051291-160051313 TTGTGGTTTTTGAGGGGTGAAGG + Intergenic
965128483 3:164662088-164662110 TTGGAGTTATTGACGGAGGTGGG - Intergenic
967274401 3:187759732-187759754 TTGGATTCCTAGAGGTGGGAGGG + Intergenic
967320957 3:188194598-188194620 CTGTAGTTCTTGAGGGAAGAAGG + Intronic
967377184 3:188817651-188817673 TTTGAATTCTTGAGGGCTGAGGG + Intronic
968596015 4:1485673-1485695 TTGGAGCTCTTCAAGGGGGAGGG - Intergenic
976776223 4:88709028-88709050 CTGGAGGTATTGAGGTGGGAAGG + Intergenic
977058775 4:92229303-92229325 TAGGACTGCTTGAGGGGGGAAGG + Intergenic
977260411 4:94790434-94790456 TTGGGGTTCTGGAGGCAGGAAGG + Intronic
977734743 4:100399916-100399938 TGGGACTTCTTGAGGGTAGAGGG - Intronic
978337749 4:107688119-107688141 TAGGAGTTCATGAAAGGGGAGGG - Intronic
980590142 4:134875895-134875917 TTGGTGTTTTTGGGTGGGGAGGG + Intergenic
982810813 4:159824024-159824046 ATGGAGATCTTGAAGGGTGAGGG - Intergenic
984237067 4:177172432-177172454 TGGGACTTCTAGAGGGAGGAGGG - Intergenic
984326285 4:178255778-178255800 AGGGAGTTGTTGAGAGGGGAAGG + Intergenic
984624873 4:181995968-181995990 CTGGGGCTCTTGAGGGAGGAAGG - Intergenic
985305187 4:188531661-188531683 GGGGACTGCTTGAGGGGGGAGGG + Intergenic
986962879 5:13237024-13237046 TTGGGGATCTTGAGGAGGGGAGG - Intergenic
988320761 5:29693264-29693286 GTGGACTTCTAGAGGGAGGAGGG - Intergenic
988717956 5:33846635-33846657 TTAGAGATCTTGATGGGGGTGGG + Intronic
989657841 5:43763091-43763113 TTGGTGTTCTTGCAGGGGTATGG + Intergenic
989859114 5:46342914-46342936 TGGGGGTTTGTGAGGGGGGAGGG + Intergenic
990210579 5:53479146-53479168 TTGCAGTTGTGGAGGGGGGAAGG + Intergenic
992491796 5:77251627-77251649 TTGGAGTTCAAGAGGGAGAAGGG - Intronic
995433318 5:112106739-112106761 TAGAAGTTCTTGAGGCAGGATGG - Intergenic
995700781 5:114932758-114932780 GTGGACTTCTAGATGGGGGAGGG - Intergenic
995759891 5:115551965-115551987 TGGGAGCTCTTGTGTGGGGATGG - Intergenic
996472772 5:123879260-123879282 TAGGAATTCCTGAGGGGGGCTGG + Intergenic
999377785 5:151098825-151098847 TTGGAGTTCTTGAGTGGGGAAGG - Intergenic
1003397287 6:5764184-5764206 ATGGAGTTATTGAGGCGAGAAGG + Intronic
1003447668 6:6199822-6199844 TTGCAGTTCTTCAGGGGTGGGGG - Intronic
1003554467 6:7127539-7127561 TTGGAATTCTTTAGAGGAGAGGG + Intronic
1003967408 6:11266244-11266266 CTGGAGTAAGTGAGGGGGGAGGG - Intronic
1004129609 6:12906779-12906801 TTGGAGTTCTTTTGGGGGACTGG - Intronic
1004861960 6:19813520-19813542 TAGGAGTTCTAGAAGAGGGATGG + Intergenic
1005374286 6:25166180-25166202 TGAGAGTTCTTGCTGGGGGATGG - Intergenic
1005392842 6:25350671-25350693 TTAAAGTTCTTGAGGAGAGAGGG + Intronic
1005600393 6:27421073-27421095 TAGGAGTTAATGAGGAGGGAGGG + Intergenic
1005687198 6:28266057-28266079 AAGGACTTCTTGAGGGTGGAGGG - Intergenic
1005935084 6:30515156-30515178 TTGAAATTCTTGAGGCAGGAAGG + Intergenic
1006378255 6:33683634-33683656 TTGGAGCTCATGAGGGGGTCGGG + Intronic
1006506575 6:34492802-34492824 ATGGACTTCTAGAGGAGGGAAGG + Intronic
1007020073 6:38511206-38511228 TAGGAGTTTTTCAGGTGGGAAGG - Intronic
1007703205 6:43776212-43776234 TTGGAGGCCTAGAGAGGGGAGGG + Intronic
1008980355 6:57476125-57476147 TTTAAGTTCATGAGGGGGTAGGG - Intronic
1010014915 6:71093407-71093429 TAGGAGTCCCTGAGGAGGGATGG + Intergenic
1010946643 6:81982049-81982071 TTTCACTTCTTGAGGGGGAATGG - Intergenic
1017408116 6:154141397-154141419 TTGGAGGCCTTGATGGGGGTGGG + Intronic
1020571440 7:9868387-9868409 TTAGGGATCTTGAGTGGGGAGGG - Intergenic
1020985988 7:15134753-15134775 TTGGGGTTTTTGAGGAAGGAAGG + Intergenic
1021523177 7:21556677-21556699 GTGGCCTTCTTGAGGGTGGAGGG - Intronic
1021564686 7:22005336-22005358 TTGGGGTTTTTGAGGTTGGAAGG - Intergenic
1021766883 7:23958527-23958549 TTGGACTTCTGAAGGGTGGAGGG - Intergenic
1021985249 7:26091933-26091955 TTAGAGTTATTGAGGGGAAAAGG - Intergenic
1024113627 7:46172302-46172324 TTGGAATGCCTGAGGGGGCAGGG + Intergenic
1025228800 7:57185284-57185306 TGGGAGTTCTTGAGGCTGCAGGG - Intergenic
1026172437 7:67965796-67965818 ATGGAGTTTTTGGGGGGTGATGG + Intergenic
1031273164 7:119681062-119681084 TTGGAGTTCTTTAAGGGGGCGGG - Intergenic
1031598438 7:123673928-123673950 GTGGAGTCTTTGAGGGAGGAGGG - Intergenic
1032371938 7:131364631-131364653 TGGGACTACTTGAGGGTGGAGGG - Intronic
1033711600 7:143951675-143951697 GTGGAGTTTTTGAGGGGAGAGGG + Intergenic
1037598236 8:20372511-20372533 TGGGAGATCTTGAGGGGGAGAGG - Intergenic
1038136109 8:24787496-24787518 TTGGAGTACTTGAGGCTTGAAGG - Intergenic
1038261059 8:25994775-25994797 TGGGACTACTTGAGGGTGGAGGG + Intronic
1038273044 8:26092328-26092350 TTGGAGTTGAGGATGGGGGAAGG - Intergenic
1041987613 8:63944272-63944294 TTGGGGTTCTTGAAGAAGGAAGG - Intergenic
1042240169 8:66655935-66655957 TTGAAGGTTATGAGGGGGGAAGG - Intronic
1043374726 8:79635744-79635766 GTGGACTACTAGAGGGGGGAAGG + Intronic
1045511942 8:102818429-102818451 TGGGAGTTCTGGAGCTGGGATGG - Intergenic
1046046959 8:108976075-108976097 TTGGAGGTATTGAGGGTGGTGGG - Intergenic
1046108562 8:109693761-109693783 ATGGAGTTCCTGAGCGGGAATGG + Intergenic
1047709121 8:127532774-127532796 TTACAGTACATGAGGGGGGAAGG + Intergenic
1048488230 8:134868215-134868237 ATGGAGAGCTTGAGAGGGGAAGG + Intergenic
1049850830 8:144829262-144829284 TTGAGGCTCTTGAGGGGGGAGGG + Intronic
1050093868 9:2043498-2043520 TTGGGGTTTTTGAGGGGTGAGGG + Intronic
1051053410 9:12956203-12956225 TAGGGGTCCTTGAGTGGGGATGG - Intergenic
1052197573 9:25736212-25736234 TTGGAGTTGCTGAGGGGAGGTGG - Intergenic
1052892101 9:33711077-33711099 TTGGAGGTCTTTGGGGGGAAAGG + Intergenic
1053189937 9:36055821-36055843 TTGTTGTTGTTGAGGGGAGATGG + Intronic
1053458655 9:38251368-38251390 GTGGAGTTCTTATGGGGGAAGGG - Intergenic
1054821947 9:69531534-69531556 CTGGAGTGCTGGAGAGGGGAAGG - Intronic
1054825330 9:69567564-69567586 GTGGGGTTGTGGAGGGGGGAGGG - Intronic
1057714470 9:97480048-97480070 TTAGAGCTCCTGAGGGAGGAAGG + Intronic
1058774286 9:108268491-108268513 TTGGAGTTTTTAACAGGGGAGGG - Intergenic
1059250543 9:112884041-112884063 TTGGAGGGCATGAGGGGAGAGGG + Intronic
1059861277 9:118465470-118465492 TGGGAGTTCTTTAGGGGTGCTGG + Intergenic
1061088132 9:128411287-128411309 TAGGAGTTGTTGAGGGGGGTGGG + Intergenic
1061261374 9:129482651-129482673 TTTGAGTTATGGAGGGGGGAGGG + Intergenic
1061728049 9:132592076-132592098 TCGGCGTTTATGAGGGGGGATGG - Intergenic
1062319412 9:135983091-135983113 TTGGAGTGCAGGAGAGGGGAGGG - Intergenic
1203485352 Un_GL000224v1:48234-48256 ATAGAGTTATTGTGGGGGGAGGG - Intergenic
1185731501 X:2465382-2465404 TTGGCGTGATTGAGGAGGGATGG - Intronic
1185784047 X:2874905-2874927 GTGGAATTCTTGGGGGTGGATGG - Intronic
1186530003 X:10285936-10285958 TTGGAGTTCTCGAGTGAGAAAGG - Intergenic
1187532640 X:20110760-20110782 TTGGTGTTCTTGAGAGGTGCTGG + Intronic
1188297149 X:28463356-28463378 TTGGAAGTCTAGAGGGCGGAAGG + Intergenic
1188486909 X:30692193-30692215 CTGAAGTTATTGTGGGGGGACGG - Intronic
1188648830 X:32604470-32604492 TTGTAGTTCTTGGGGGAGGGGGG - Intronic
1188815437 X:34706531-34706553 TTGGTGTCCTTGTGTGGGGAGGG + Intergenic
1189567163 X:42254893-42254915 TTGGTGCTGTTGAGGGGGGCGGG + Intergenic
1190274859 X:48893131-48893153 TTGGAGTGTGTGGGGGGGGATGG + Intergenic
1191820431 X:65300311-65300333 TTGGTGCTGTTGAGGGGGCAGGG + Intergenic
1193078521 X:77381766-77381788 TTGGTGTCCTTTTGGGGGGATGG - Intergenic
1194245489 X:91506531-91506553 TTGGACTTCTAGAGAGGGGAGGG + Intergenic
1195960708 X:110383305-110383327 TAGGAGTTCTTGAAGGGAGGAGG - Intronic
1196061394 X:111411513-111411535 TTGGGGTTCTTGGTGGGGGAGGG - Intronic
1196575606 X:117314812-117314834 TGGGACTACTTGAGGGGGGAGGG - Intergenic
1196675778 X:118419030-118419052 TTGGGGCTGTTGAGGGGGCATGG - Intronic
1196904653 X:120419409-120419431 TTGGAGTGCTGGAGGGGAAAGGG + Intergenic
1197132100 X:123017438-123017460 GGGGTGTTCTTGAGGGTGGAGGG - Intergenic
1198068436 X:133123368-133123390 TGGGCCTTCTTGAGGGTGGAGGG - Intergenic
1198131704 X:133702589-133702611 TTGGGGTTGGTGAGGGGGGAGGG - Intronic
1199992129 X:152993287-152993309 TTGGACTTGGTGAGGGGGCAGGG - Intronic
1200327306 X:155254750-155254772 TTCTAGTTTTTGAGTGGGGAAGG + Intergenic
1200330064 X:155286133-155286155 GGGGTGTTCTTGAGGGTGGAGGG - Intronic
1200564459 Y:4747783-4747805 TTGGACTTCTAGAGAGGGGAGGG + Intergenic
1201269835 Y:12243993-12244015 CTGGAAGTCTTGAGGTGGGAGGG - Intergenic