ID: 1078012556

View in Genome Browser
Species Human (GRCh38)
Location 11:7584110-7584132
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 236
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 215}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078012556_1078012562 -5 Left 1078012556 11:7584110-7584132 CCTTATTCCCTGTAATACTACAG 0: 1
1: 0
2: 0
3: 20
4: 215
Right 1078012562 11:7584128-7584150 TACAGAGCTTTTTAAGGGCAGGG 0: 1
1: 0
2: 2
3: 25
4: 259
1078012556_1078012563 24 Left 1078012556 11:7584110-7584132 CCTTATTCCCTGTAATACTACAG 0: 1
1: 0
2: 0
3: 20
4: 215
Right 1078012563 11:7584157-7584179 TCATTGTTTAGCACAGAAAGTGG 0: 1
1: 1
2: 1
3: 19
4: 264
1078012556_1078012561 -6 Left 1078012556 11:7584110-7584132 CCTTATTCCCTGTAATACTACAG 0: 1
1: 0
2: 0
3: 20
4: 215
Right 1078012561 11:7584127-7584149 CTACAGAGCTTTTTAAGGGCAGG 0: 1
1: 0
2: 0
3: 15
4: 150
1078012556_1078012560 -10 Left 1078012556 11:7584110-7584132 CCTTATTCCCTGTAATACTACAG 0: 1
1: 0
2: 0
3: 20
4: 215
Right 1078012560 11:7584123-7584145 AATACTACAGAGCTTTTTAAGGG 0: 1
1: 0
2: 2
3: 33
4: 401

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078012556 Original CRISPR CTGTAGTATTACAGGGAATA AGG (reversed) Intronic
904665400 1:32116858-32116880 TTGTTGTATCTCAGGGAATAGGG + Intronic
905552934 1:38858892-38858914 CTGTAGCATTACTGGGAATTGGG - Intronic
905705181 1:40050936-40050958 ATGGAGTATTATAGGGAACAAGG - Intronic
910328571 1:86040681-86040703 CTGTAGTATGACAGGGTGTATGG - Intronic
910435305 1:87200152-87200174 TTGTGGTATTACAGGGACTCTGG + Intergenic
911759085 1:101596325-101596347 CTGTTGTGTTTCAGGGAAAAGGG + Intergenic
911928930 1:103875144-103875166 TTGTTGTATCTCAGGGAATAGGG + Intergenic
911969897 1:104419290-104419312 TTGTTGTGTTTCAGGGAATAAGG + Intergenic
918556354 1:185804467-185804489 CTGTAGTATTAAAGTAAATCAGG - Intronic
919612811 1:199767108-199767130 CTGTTTTGTTTCAGGGAATAGGG - Intergenic
921419831 1:214933653-214933675 CTCTAGAATTACCAGGAATAAGG + Intergenic
922659147 1:227414053-227414075 CTGTTGTATCTCATGGAATAGGG + Intergenic
922903128 1:229153805-229153827 GTGTTGTATCTCAGGGAATAGGG + Intergenic
923128057 1:231049476-231049498 CTGTAGTACTAAAGGGTATATGG - Intergenic
923221952 1:231903409-231903431 CTGTAGATTTACATGGAGTAAGG + Intronic
923276011 1:232396986-232397008 CTGGAGATTTTCAGGGAATAAGG - Intergenic
924079174 1:240375037-240375059 CTGTTGTGTCTCAGGGAATATGG + Intronic
1062995625 10:1863610-1863632 TTGTTGTATTTCAGGGAATAAGG - Intergenic
1066674439 10:37873688-37873710 CTGAAGTATTACACACAATAAGG - Intergenic
1068257353 10:54530366-54530388 CTGCAGGAATACAGAGAATAAGG - Intronic
1068559132 10:58493456-58493478 TTGTTGTATTGCAGGGAACAGGG - Intergenic
1072703927 10:97666321-97666343 CTGTTGTATGTCAGGGAAGAGGG + Intronic
1073028422 10:100505795-100505817 CTGTAGTATTTCAGGGACCGTGG - Intronic
1074206331 10:111286180-111286202 CTGGAGTATCCCAGGAAATATGG - Intergenic
1074691467 10:116008747-116008769 TTGTTGTGTCACAGGGAATAGGG - Intergenic
1075193342 10:120331586-120331608 CTGTTGTGTTTCAGGGAATAGGG - Intergenic
1075691366 10:124397008-124397030 CTGTTGAACTACAGGGTATATGG - Intergenic
1078012556 11:7584110-7584132 CTGTAGTATTACAGGGAATAAGG - Intronic
1079159972 11:17983117-17983139 TTGTGGTCTTACAAGGAATATGG - Intronic
1079275971 11:19038062-19038084 CTGGAGTAATCCAGGGAAGAAGG - Intergenic
1079532504 11:21472041-21472063 CTTTAGTATTAGAGTCAATATGG + Intronic
1080113809 11:28599424-28599446 CTGGAGTCTTAAAGGGAAAATGG + Intergenic
1080124052 11:28710553-28710575 AAGGAGTATAACAGGGAATAGGG + Intergenic
1081176654 11:39935402-39935424 TTGTTTTATTTCAGGGAATAGGG - Intergenic
1081387757 11:42492288-42492310 CTGAAGGAGTACAGGGAAGACGG - Intergenic
1082593211 11:55041051-55041073 ATTTAGTCTTACAGGGAAAAAGG - Intergenic
1085608992 11:77929365-77929387 CTTTAGTATCACAAGGACTATGG + Intronic
1087540576 11:99512825-99512847 CTGTTGTGTCTCAGGGAATAAGG - Intronic
1087657800 11:100946573-100946595 TTGTTGTATCTCAGGGAATAGGG + Intronic
1089227415 11:116937581-116937603 CAGTAGTATTACAAATAATAAGG - Intronic
1089714662 11:120346763-120346785 CTGGAGTAATAAAGGGAACAAGG - Intronic
1089727328 11:120493745-120493767 CCATAATATTACAGGAAATATGG - Intergenic
1091055047 11:132410135-132410157 CTGTAATATTACAGGCAAATTGG + Intergenic
1093699466 12:22202524-22202546 CTATAATATTACATGGAAAAAGG + Intronic
1094632645 12:32191892-32191914 CTGTTGTGTCTCAGGGAATAGGG - Intronic
1095936864 12:47693216-47693238 CTGTTGTGTCTCAGGGAATAGGG + Intronic
1099433909 12:82620508-82620530 CTATAGTGTTACTGGGCATAAGG + Intergenic
1100050196 12:90439377-90439399 TTGTTGTATTTCAGGGAATAAGG - Intergenic
1100618734 12:96251372-96251394 TTGTTGTGTTTCAGGGAATAGGG - Intronic
1102048440 12:109845006-109845028 TTGCAGTATTACATGAAATAAGG - Intergenic
1105868238 13:24480317-24480339 TTGTTGTATCTCAGGGAATAGGG - Intronic
1105933291 13:25072428-25072450 ATGAAGAAATACAGGGAATAGGG + Intergenic
1106713550 13:32364514-32364536 CTGTATTAGTAGAGGGAAGATGG - Intronic
1106989460 13:35399875-35399897 CTGTTGTGTCTCAGGGAATAGGG + Intronic
1107645024 13:42485278-42485300 ATGTATTATTACAGAGAAGAAGG - Intergenic
1109247197 13:59969546-59969568 CTTTAATATTACAGTGACTAGGG - Intronic
1112856692 13:103779538-103779560 TTGTTGTATCTCAGGGAATAGGG + Intergenic
1114950069 14:27739152-27739174 TTGTTGTGTTTCAGGGAATAAGG - Intergenic
1115308239 14:31953848-31953870 TTGTTGTGTCACAGGGAATAGGG - Intergenic
1116628018 14:47291864-47291886 CTGTAATATTACAGTGCACAAGG - Intronic
1118462890 14:66002875-66002897 CTGTAGAATTCCAGGCACTAAGG - Intronic
1118466914 14:66039377-66039399 CTGAAGTATTCTTGGGAATAAGG - Intergenic
1119447226 14:74675947-74675969 CTGAAGTATAATAAGGAATAAGG + Intronic
1119919030 14:78429009-78429031 TTGTAATATCACTGGGAATAGGG - Intronic
1124203018 15:27694492-27694514 CTGTAGGATTACAGGAAGCATGG - Intergenic
1124461025 15:29891826-29891848 ATGTTGTATCTCAGGGAATAAGG - Intronic
1125191386 15:36997960-36997982 CTGTGATATGACAGGGGATAGGG - Intronic
1125305197 15:38304416-38304438 CTGTGGTATTACGGTGAATAGGG - Intronic
1125767745 15:42146433-42146455 CTGTACAATTCCAGGGACTATGG + Intronic
1127207620 15:56736760-56736782 CTGAATTATTGCAGTGAATATGG + Intronic
1127504199 15:59582332-59582354 CTGAAGCATTCCAGGGAAAAGGG - Intergenic
1128024406 15:64422816-64422838 CTGAAGAATTACTGGGAAAATGG - Intronic
1138923581 16:61563743-61563765 CTGTAGGATTAAAGGCAAAACGG - Intergenic
1138933202 16:61687164-61687186 TTGTGGTATTACAGGAAAAAAGG - Intronic
1139101976 16:63778541-63778563 ATGTAGATTTACAGGGAATTAGG - Intergenic
1140162622 16:72513766-72513788 CTGTTGTATCTTAGGGAATAGGG + Intergenic
1141998633 16:87650395-87650417 CTGTTGTGTCTCAGGGAATAGGG - Intronic
1143842799 17:9746742-9746764 CTGTAGTACTACAGGTAGCAAGG + Intergenic
1144278323 17:13699031-13699053 CTGTAGTATAACAAGGATCAGGG + Intergenic
1146412699 17:32601336-32601358 TTGTTGTATCTCAGGGAATAGGG + Intronic
1148254994 17:46122922-46122944 TTGTTGTGTTTCAGGGAATAGGG - Intronic
1150662635 17:67097076-67097098 CTGTTGTGTCTCAGGGAATAGGG + Intronic
1156716891 18:40022853-40022875 CTTCACTATTCCAGGGAATAGGG + Intergenic
1157171221 18:45407723-45407745 CTGTTGTATCTCAGGGATTAAGG + Intronic
1158278728 18:55797123-55797145 TTCTAGTATTACACAGAATAGGG + Intergenic
1158978152 18:62731515-62731537 CTGTTGTGTCTCAGGGAATAGGG - Intronic
1160598880 18:79997366-79997388 TTTTTGTTTTACAGGGAATATGG - Intronic
1160602836 18:80027301-80027323 TTTTTGTTTTACAGGGAATATGG - Intronic
1164744478 19:30601073-30601095 CTGTGGGAACACAGGGAATATGG - Intronic
1165371695 19:35411639-35411661 GTGTGGTATTAAAGGGAAGAAGG - Intergenic
1166504787 19:43364433-43364455 CTGTAGTTTTCCATGGAACAGGG + Intergenic
926176621 2:10598453-10598475 CTGTGGGAATACAGGGAATGTGG + Intronic
926387967 2:12356594-12356616 TTGTTGTATCTCAGGGAATAGGG + Intergenic
926722270 2:15969848-15969870 CTGTTGTGTTTCAGGGAATAGGG + Intergenic
927454582 2:23238466-23238488 CTGTAGGAGGACAGGGCATAGGG + Intergenic
927755325 2:25703945-25703967 TTGTTGTATGTCAGGGAATAGGG - Intergenic
930034880 2:47079097-47079119 CTGAAGTATTAAGGGGAACAGGG - Intronic
930480997 2:51948007-51948029 CTGCAGTATTATGGGGAACATGG + Intergenic
932631662 2:73349316-73349338 CTATAGTATTGCAGAAAATATGG - Intergenic
932760118 2:74433875-74433897 CTGTAGTATTGCAGACATTAAGG + Intronic
932817575 2:74874192-74874214 CAGTAGTATAAGAGGGAAGAGGG + Intronic
933573918 2:84045224-84045246 CTGTAGAATAACAGGGGATCAGG + Intergenic
936721974 2:115262870-115262892 CTGTAGAATTACATGGAATTTGG - Intronic
937818538 2:126281042-126281064 CTGTTGTGTCTCAGGGAATAGGG - Intergenic
939155366 2:138518382-138518404 CAGGAGTATTACAGGAGATAAGG - Intronic
939517069 2:143182317-143182339 CTGTGGTATCTCAGAGAATAGGG + Intronic
941885927 2:170527259-170527281 AAGAACTATTACAGGGAATAAGG + Intronic
942507769 2:176661573-176661595 TTGTTGTATCTCAGGGAATAGGG - Intergenic
942716332 2:178896734-178896756 CTGCAGTGTGACAGGCAATAGGG + Intronic
943285854 2:185999132-185999154 TGGTTGTGTTACAGGGAATAGGG - Intergenic
943905699 2:193499179-193499201 TTGTTGTGTTTCAGGGAATAGGG - Intergenic
944010648 2:194970274-194970296 CTGTTGTGTCACAGTGAATAGGG - Intergenic
944953083 2:204775618-204775640 CTGTATTATGACAGAGAAAATGG - Intronic
945291925 2:208135336-208135358 CTCCTGTATTACAGGGATTAGGG + Intergenic
945718063 2:213382833-213382855 CTTTAGTTTGACAGAGAATAGGG + Intronic
946315781 2:218910980-218911002 CTGGAGACTTATAGGGAATAGGG + Intergenic
1170006257 20:11672777-11672799 CTTGAGGATTACAGGGAATATGG - Intergenic
1170398939 20:15959265-15959287 ATCTGGTATTACAGGAAATAGGG - Intronic
1172921149 20:38483459-38483481 CTGTAGTATTACATATAAGATGG - Intronic
1175209842 20:57346776-57346798 GTGTAGCTTTACAGGGAATTGGG - Intergenic
1176930143 21:14800149-14800171 CTGTAGTATAACATGGAGTCAGG + Intergenic
1177431937 21:21000605-21000627 CTGTTTCATTACAGTGAATATGG - Intronic
1177489156 21:21799779-21799801 CTGAAGTATTGCAGAGAAGAGGG + Intergenic
1178051583 21:28753412-28753434 CTCTAGTATTGCAGGCACTAAGG - Intergenic
1178635751 21:34301200-34301222 ATGTAGTAATACAGAGAATGGGG + Intergenic
1178732410 21:35116967-35116989 CTGTAGTATGGCAGGGATTCAGG + Intronic
1179814221 21:43893692-43893714 CTGCTGTGTAACAGGGAATAGGG + Intronic
1180878959 22:19190280-19190302 CTGTTGTGTCTCAGGGAATAGGG + Intronic
1183133401 22:35862417-35862439 CTGTAGTGTTTTAGGGAAGACGG - Intronic
1183757887 22:39787285-39787307 CTGTTGTGTCTCAGGGAATAGGG - Intronic
949387966 3:3526021-3526043 ATCTAGTATTATAGTGAATATGG - Intergenic
949959658 3:9301576-9301598 CTGTAGAATTACAGTGAGCACGG + Intronic
950632424 3:14291620-14291642 CTGTTGTGTTTCAGGAAATAGGG - Intergenic
951276151 3:20688658-20688680 TTGTTGTGTTTCAGGGAATAGGG + Intergenic
951307218 3:21079680-21079702 TGGTTGTATTTCAGGGAATAGGG + Intergenic
958895194 3:99821533-99821555 CTGAAGGTTTACAGGGAATAAGG - Intronic
962836846 3:139197102-139197124 TTGTTGTATTTCAGAGAATAGGG + Intronic
963318590 3:143787544-143787566 CTGTAATATCACATGTAATATGG - Intronic
967848579 3:194064466-194064488 CTGTAGAATTATAGAGGATAGGG - Intergenic
967983548 3:195079409-195079431 CTGAAGAAATACAGGGAAAACGG + Intronic
970945197 4:21682733-21682755 CTGTTGTATCTCAGGAAATAGGG + Intronic
971211804 4:24624868-24624890 CTGCTGTCTTCCAGGGAATATGG - Intergenic
973200745 4:47499150-47499172 CTGAAGTATTTCAGGTAATGAGG + Intronic
973578215 4:52314305-52314327 CAATAGTATTACAGGGAGAATGG - Intergenic
974587137 4:63894151-63894173 CTGTAGCATTACAGTCACTAAGG - Intergenic
974762988 4:66302758-66302780 CTGTATTCTTACATGGCATAAGG + Intergenic
974826280 4:67134746-67134768 TTGTTGTAGTACAGGGAAAAAGG - Intergenic
975686545 4:76921488-76921510 CTGTTGTATCTCAGGGAATAGGG + Intergenic
977387581 4:96362545-96362567 CTGTAGTAGTACTCTGAATAAGG + Intergenic
977615426 4:99083097-99083119 CTGCAGTTTTGCAGGGAAGATGG + Intronic
979345630 4:119583684-119583706 CTGTTGTCTCTCAGGGAATAGGG + Intronic
979846239 4:125516185-125516207 GTGTTGTGTCACAGGGAATAGGG + Intergenic
982458873 4:155643097-155643119 TTGTTGTGTTTCAGGGAATAGGG - Intergenic
982483723 4:155941673-155941695 CAGTAGCATGACAGGGATTATGG - Intronic
983426354 4:167588787-167588809 CAGTGGTATTCCATGGAATAGGG - Intergenic
983701993 4:170608406-170608428 TTGTTGTATCTCAGGGAATAGGG + Intergenic
985284144 4:188317585-188317607 CTGAAGTATTTCAGGTAATCGGG + Intergenic
989287819 5:39722645-39722667 CTGTTGTATCTCAGGGAATAGGG + Intergenic
989532385 5:42523645-42523667 TTGTTGTGTTTCAGGGAATAGGG - Intronic
990677040 5:58198730-58198752 CTGTTGTGTATCAGGGAATAGGG + Intergenic
991618042 5:68517363-68517385 CTATTGTGTTACAGGGGATATGG + Intergenic
992918341 5:81482993-81483015 CTGTTGTGTCTCAGGGAATAGGG + Intronic
993959602 5:94280690-94280712 CTGTAATATTTCAGGTAATGAGG + Intronic
994728948 5:103469713-103469735 ATGTAGTATTTCGGGGAACAGGG - Intergenic
994757123 5:103808186-103808208 TTGTAATATTACATGGAAGAAGG - Intergenic
995505801 5:112859783-112859805 TTGTTGTGTTTCAGGGAATAGGG + Intronic
995945086 5:117635424-117635446 TTGTAGAATTACAGGGAAAAGGG - Intergenic
996351966 5:122553867-122553889 TTGTTGTATGTCAGGGAATAGGG - Intergenic
997047586 5:130337466-130337488 CTGTATTATTAAACAGAATAAGG + Intergenic
998591252 5:143480698-143480720 CTCTAGGATTACAGTGATTATGG + Intergenic
998603271 5:143606606-143606628 CTGAAGTATGAAAGGGAATATGG - Intergenic
1001174854 5:169458740-169458762 CTGTAGTTTTTCAGGGGACAGGG + Intergenic
1001655882 5:173349236-173349258 TTGTTGTATCTCAGGGAATAAGG - Intergenic
1003451239 6:6234364-6234386 ATGAAGTACTTCAGGGAATATGG + Intronic
1003996172 6:11541846-11541868 TTGTTGTATCTCAGGGAATAGGG + Intronic
1005275169 6:24209276-24209298 TAGTAGTAATAAAGGGAATATGG - Intronic
1008916841 6:56797301-56797323 CTGTTGTGTTTCAGGGAATAAGG - Intronic
1009627318 6:66151873-66151895 CTGTTGTATCTCAGGGAATAGGG - Intergenic
1010898480 6:81396126-81396148 CTGTTGTTTTGGAGGGAATAAGG - Intergenic
1013030868 6:106331388-106331410 TTGTAGTGTCTCAGGGAATAGGG - Intergenic
1013266462 6:108504359-108504381 TTGTTGTATCTCAGGGAATAGGG + Intronic
1014274359 6:119369929-119369951 CTGAACTATTACACGGAATGGGG + Intergenic
1018599213 6:165521272-165521294 CTGTTGTGTCTCAGGGAATAAGG - Intronic
1019869053 7:3741562-3741584 CTGTAGTATTAAAGTTAATTAGG - Intronic
1020570674 7:9857066-9857088 CTGTTGTATCTCAAGGAATAGGG + Intergenic
1023218326 7:37890263-37890285 CTGTTTTATTACAGTGAATTTGG - Intronic
1023778454 7:43633382-43633404 CTGTTGTGTCTCAGGGAATAGGG + Intronic
1025843903 7:65178453-65178475 CTTTAGTATCACAAGGACTATGG - Intergenic
1025894236 7:65684764-65684786 CTTTAGTATCACAAGGACTATGG - Intergenic
1026908546 7:74078737-74078759 CTGCAGGATGACAGGGCATAGGG + Intergenic
1027917643 7:84346540-84346562 CTGTTGTGTCTCAGGGAATAAGG + Intronic
1028759847 7:94483709-94483731 CTGTAGTATTGGAAGGAATGGGG - Intergenic
1029026867 7:97425831-97425853 ATATAGTATTACTGGAAATAAGG + Intergenic
1033080568 7:138293156-138293178 CTGTTGTGTCTCAGGGAATAGGG + Intergenic
1033140882 7:138825322-138825344 CTGTTGTGTCTCAGGGAATAGGG - Intronic
1036404178 8:8440367-8440389 CTCTAGTTTTACAAGGAATCAGG - Intergenic
1037303727 8:17482449-17482471 TTGTTGTATATCAGGGAATAGGG - Intergenic
1037428674 8:18785805-18785827 CTGTTGTGTCTCAGGGAATAGGG + Intronic
1039266754 8:35833084-35833106 TTGTTGTATTTCAAGGAATACGG - Intergenic
1039735116 8:40323502-40323524 CTGAAGGATTGCAGGCAATATGG + Intergenic
1040459795 8:47636340-47636362 TTGTTGTGTTTCAGGGAATAGGG - Intronic
1041800472 8:61792460-61792482 CTGGAGTGTTTCAGGGAAAAAGG + Intergenic
1041926253 8:63240075-63240097 CTGTTGTGTCTCAGGGAATAGGG + Intergenic
1042409829 8:68451546-68451568 TTGTTGTGTTTCAGGGAATAGGG + Intronic
1043987848 8:86715169-86715191 CTGCAGTACTATAGGGTATAGGG - Intronic
1044183918 8:89229211-89229233 CTGTAGTATTCCAGCGAGTTAGG - Intergenic
1044414438 8:91920192-91920214 TTGTTGTGTTTCAGGGAATAGGG - Intergenic
1044566352 8:93664918-93664940 CTGTGATATTAGAAGGAATATGG - Intergenic
1046695997 8:117340313-117340335 CTGCAGTATGCCAGGGAAGAAGG + Intergenic
1048433390 8:134391503-134391525 TTGTTGTATCTCAGGGAATAGGG - Intergenic
1048513024 8:135079440-135079462 CAGTAGTATTAGAGGGTAAAGGG + Intergenic
1048937509 8:139369113-139369135 CTGTAGCATTTCAGGGAAGTTGG - Intergenic
1050321422 9:4456740-4456762 CTGTTGTGTTTCAGGGAATTGGG + Intergenic
1050867379 9:10519917-10519939 TTGTAGTGTCTCAGGGAATAGGG - Intronic
1051540514 9:18211333-18211355 CTGTAGAATGAAATGGAATAGGG - Intergenic
1051753581 9:20370422-20370444 TTGTTGTATCTCAGGGAATAGGG - Intronic
1054904436 9:70402260-70402282 CTGTAGAATTACAGAGCACAGGG + Intronic
1055807392 9:80111847-80111869 CTGTTGTGTCTCAGGGAATAGGG + Intergenic
1057172362 9:92970554-92970576 CTGTTGAACTACAGGGAATGTGG + Intronic
1057543228 9:95995903-95995925 CTGTTGCATTTCAGGGAATGGGG - Intronic
1059237259 9:112771381-112771403 ATGTGGTATTAAAAGGAATAAGG + Intronic
1187677829 X:21735532-21735554 CTGTGTGATTACAGGGAACAAGG - Intronic
1188855617 X:35191657-35191679 ATGTTGTATCCCAGGGAATAGGG + Intergenic
1189263702 X:39697187-39697209 TTGTTGTATCTCAGGGAATAGGG + Intergenic
1189942613 X:46141200-46141222 CTGTTGTATCTCAGGGAATAGGG - Intergenic
1190685518 X:52869243-52869265 CTATAGTAATCCAGGGAATGTGG - Intergenic
1190748124 X:53338736-53338758 CTGTAGTGTTAGGAGGAATATGG - Intergenic
1190798800 X:53769944-53769966 CTGTAGTGTTAGGAGGAATATGG - Intergenic
1191829266 X:65398355-65398377 CTGTAGTATAATATGGAATCAGG - Intronic
1196248112 X:113424899-113424921 CTGTAGCATTAAAGTGACTATGG + Intergenic
1196721362 X:118857478-118857500 TTGTTGTATTTCAGGGAATAGGG - Intergenic
1200371800 X:155734290-155734312 CTGTTGTATTTTAGGGAATAGGG + Intergenic
1201336839 Y:12890808-12890830 CTGTTGTCTTACAGTGAATGGGG + Intergenic
1201518339 Y:14842878-14842900 TTGTAGTATTACAAGGCAGAAGG + Exonic
1201849465 Y:18462196-18462218 CTATAGCATTTCTGGGAATAAGG - Intergenic
1201883853 Y:18858179-18858201 CTATAGCATTTCTGGGAATAAGG + Intergenic