ID: 1078014562

View in Genome Browser
Species Human (GRCh38)
Location 11:7601975-7601997
Sequence ACTCAGCCTCCCAAGTAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 834315
Summary {0: 1035, 1: 102272, 2: 213099, 3: 252751, 4: 265158}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078014562_1078014566 6 Left 1078014562 11:7601975-7601997 CCCAGCTACTTGGGAGGCTGAGT 0: 1035
1: 102272
2: 213099
3: 252751
4: 265158
Right 1078014566 11:7602004-7602026 AATCGCTGGAACCCGAGAGACGG 0: 2
1: 57
2: 1893
3: 22340
4: 81864
1078014562_1078014565 -8 Left 1078014562 11:7601975-7601997 CCCAGCTACTTGGGAGGCTGAGT 0: 1035
1: 102272
2: 213099
3: 252751
4: 265158
Right 1078014565 11:7601990-7602012 GGCTGAGTCAGGAGAATCGCTGG 0: 17
1: 1455
2: 4893
3: 4391
4: 3721
1078014562_1078014567 9 Left 1078014562 11:7601975-7601997 CCCAGCTACTTGGGAGGCTGAGT 0: 1035
1: 102272
2: 213099
3: 252751
4: 265158
Right 1078014567 11:7602007-7602029 CGCTGGAACCCGAGAGACGGAGG 0: 2
1: 33
2: 847
3: 12472
4: 60059

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078014562 Original CRISPR ACTCAGCCTCCCAAGTAGCT GGG (reversed) Intronic