ID: 1078014563

View in Genome Browser
Species Human (GRCh38)
Location 11:7601976-7601998
Sequence GACTCAGCCTCCCAAGTAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 760519
Summary {0: 703, 1: 88358, 2: 200412, 3: 240708, 4: 230338}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078014563_1078014565 -9 Left 1078014563 11:7601976-7601998 CCAGCTACTTGGGAGGCTGAGTC 0: 703
1: 88358
2: 200412
3: 240708
4: 230338
Right 1078014565 11:7601990-7602012 GGCTGAGTCAGGAGAATCGCTGG 0: 17
1: 1455
2: 4893
3: 4391
4: 3721
1078014563_1078014567 8 Left 1078014563 11:7601976-7601998 CCAGCTACTTGGGAGGCTGAGTC 0: 703
1: 88358
2: 200412
3: 240708
4: 230338
Right 1078014567 11:7602007-7602029 CGCTGGAACCCGAGAGACGGAGG 0: 2
1: 33
2: 847
3: 12472
4: 60059
1078014563_1078014566 5 Left 1078014563 11:7601976-7601998 CCAGCTACTTGGGAGGCTGAGTC 0: 703
1: 88358
2: 200412
3: 240708
4: 230338
Right 1078014566 11:7602004-7602026 AATCGCTGGAACCCGAGAGACGG 0: 2
1: 57
2: 1893
3: 22340
4: 81864

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078014563 Original CRISPR GACTCAGCCTCCCAAGTAGC TGG (reversed) Intronic