ID: 1078014565 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 11:7601990-7602012 |
| Sequence | GGCTGAGTCAGGAGAATCGC TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 14477 | |||
| Summary | {0: 17, 1: 1455, 2: 4893, 3: 4391, 4: 3721} |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1078014562_1078014565 | -8 | Left | 1078014562 | 11:7601975-7601997 | CCCAGCTACTTGGGAGGCTGAGT | 0: 1035 1: 102272 2: 213099 3: 252751 4: 265158 |
||
| Right | 1078014565 | 11:7601990-7602012 | GGCTGAGTCAGGAGAATCGCTGG | 0: 17 1: 1455 2: 4893 3: 4391 4: 3721 |
||||
| 1078014560_1078014565 | 0 | Left | 1078014560 | 11:7601967-7601989 | CCTGTAATCCCAGCTACTTGGGA | 0: 48553 1: 142115 2: 242012 3: 520212 4: 384467 |
||
| Right | 1078014565 | 11:7601990-7602012 | GGCTGAGTCAGGAGAATCGCTGG | 0: 17 1: 1455 2: 4893 3: 4391 4: 3721 |
||||
| 1078014563_1078014565 | -9 | Left | 1078014563 | 11:7601976-7601998 | CCAGCTACTTGGGAGGCTGAGTC | 0: 703 1: 88358 2: 200412 3: 240708 4: 230338 |
||
| Right | 1078014565 | 11:7601990-7602012 | GGCTGAGTCAGGAGAATCGCTGG | 0: 17 1: 1455 2: 4893 3: 4391 4: 3721 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1078014565 | Original CRISPR | GGCTGAGTCAGGAGAATCGC TGG | Intronic | ||