ID: 1078014566

View in Genome Browser
Species Human (GRCh38)
Location 11:7602004-7602026
Sequence AATCGCTGGAACCCGAGAGA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 106156
Summary {0: 2, 1: 57, 2: 1893, 3: 22340, 4: 81864}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078014562_1078014566 6 Left 1078014562 11:7601975-7601997 CCCAGCTACTTGGGAGGCTGAGT 0: 1035
1: 102272
2: 213099
3: 252751
4: 265158
Right 1078014566 11:7602004-7602026 AATCGCTGGAACCCGAGAGACGG 0: 2
1: 57
2: 1893
3: 22340
4: 81864
1078014563_1078014566 5 Left 1078014563 11:7601976-7601998 CCAGCTACTTGGGAGGCTGAGTC 0: 703
1: 88358
2: 200412
3: 240708
4: 230338
Right 1078014566 11:7602004-7602026 AATCGCTGGAACCCGAGAGACGG 0: 2
1: 57
2: 1893
3: 22340
4: 81864
1078014560_1078014566 14 Left 1078014560 11:7601967-7601989 CCTGTAATCCCAGCTACTTGGGA 0: 48553
1: 142115
2: 242012
3: 520212
4: 384467
Right 1078014566 11:7602004-7602026 AATCGCTGGAACCCGAGAGACGG 0: 2
1: 57
2: 1893
3: 22340
4: 81864

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078014566 Original CRISPR AATCGCTGGAACCCGAGAGA CGG Intronic