ID: 1078014567

View in Genome Browser
Species Human (GRCh38)
Location 11:7602007-7602029
Sequence CGCTGGAACCCGAGAGACGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 73413
Summary {0: 2, 1: 33, 2: 847, 3: 12472, 4: 60059}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078014562_1078014567 9 Left 1078014562 11:7601975-7601997 CCCAGCTACTTGGGAGGCTGAGT 0: 1035
1: 102272
2: 213099
3: 252751
4: 265158
Right 1078014567 11:7602007-7602029 CGCTGGAACCCGAGAGACGGAGG 0: 2
1: 33
2: 847
3: 12472
4: 60059
1078014560_1078014567 17 Left 1078014560 11:7601967-7601989 CCTGTAATCCCAGCTACTTGGGA 0: 48553
1: 142115
2: 242012
3: 520212
4: 384467
Right 1078014567 11:7602007-7602029 CGCTGGAACCCGAGAGACGGAGG 0: 2
1: 33
2: 847
3: 12472
4: 60059
1078014563_1078014567 8 Left 1078014563 11:7601976-7601998 CCAGCTACTTGGGAGGCTGAGTC 0: 703
1: 88358
2: 200412
3: 240708
4: 230338
Right 1078014567 11:7602007-7602029 CGCTGGAACCCGAGAGACGGAGG 0: 2
1: 33
2: 847
3: 12472
4: 60059

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078014567 Original CRISPR CGCTGGAACCCGAGAGACGG AGG Intronic