ID: 1078015535

View in Genome Browser
Species Human (GRCh38)
Location 11:7610444-7610466
Sequence GCCTTCCCAGGTCTGAGCTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 263
Summary {0: 1, 1: 0, 2: 3, 3: 31, 4: 228}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078015535_1078015538 5 Left 1078015535 11:7610444-7610466 CCTAAGCTCAGACCTGGGAAGGC 0: 1
1: 0
2: 3
3: 31
4: 228
Right 1078015538 11:7610472-7610494 TAATGTGAATTTAGGCCATCTGG 0: 1
1: 0
2: 0
3: 11
4: 149
1078015535_1078015540 21 Left 1078015535 11:7610444-7610466 CCTAAGCTCAGACCTGGGAAGGC 0: 1
1: 0
2: 3
3: 31
4: 228
Right 1078015540 11:7610488-7610510 CATCTGGTCAACTCCCAGCCTGG 0: 1
1: 0
2: 1
3: 18
4: 173
1078015535_1078015537 -3 Left 1078015535 11:7610444-7610466 CCTAAGCTCAGACCTGGGAAGGC 0: 1
1: 0
2: 3
3: 31
4: 228
Right 1078015537 11:7610464-7610486 GGCTGTCATAATGTGAATTTAGG 0: 1
1: 0
2: 2
3: 19
4: 273

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078015535 Original CRISPR GCCTTCCCAGGTCTGAGCTT AGG (reversed) Intronic
900031925 1:378660-378682 GCCTCCCCAGGGCTGGGCTGTGG + Intergenic
900052473 1:606846-606868 GCCTCCCCAGGGCTGGGCTGTGG + Intergenic
900638508 1:3677012-3677034 GCCTTCTGAGGTCTCAGCCTAGG - Intronic
901505382 1:9681942-9681964 GTCTGCCCAGGACTTAGCTTTGG + Intronic
902778172 1:18687820-18687842 GCCTTCCCCAGTCTGGGCTTCGG + Intronic
902916684 1:19644097-19644119 GCCCGCCCCGGGCTGAGCTTCGG - Intronic
903670750 1:25034104-25034126 GCCTTCCCCTTTCTGAGCCTGGG - Intergenic
904702532 1:32366442-32366464 CCCTTCCCAGGTGTGAGCAGAGG + Intronic
906129705 1:43448698-43448720 GAGTTCCCAAGTCTGGGCTTTGG - Exonic
907492027 1:54814523-54814545 CCCTTTCCAGATCTGGGCTTCGG - Intronic
907915964 1:58870408-58870430 GCCTTGCCTGGTCAGTGCTTAGG - Intergenic
908004644 1:59715275-59715297 GCCTTCCTTGGTCTCAGCATTGG - Intronic
912937031 1:114012539-114012561 GCCTCCCCAGGTCTCTGCTGTGG + Intergenic
914884310 1:151572830-151572852 TCCTCCCCAGTTCTGACCTTGGG + Intronic
915296873 1:154927634-154927656 GACTTCCCAGGGCGGACCTTTGG - Intronic
915475851 1:156152446-156152468 GGCTTCCCAAATCTGAGCTGGGG + Intronic
915561278 1:156689704-156689726 CCCGTCCCATTTCTGAGCTTGGG + Intergenic
916643950 1:166763485-166763507 GCTTTCCCAGGTGAGAGATTTGG - Intergenic
919787377 1:201268402-201268424 GCCCACCCAGGTCTGGGCTGGGG - Intergenic
922748145 1:228058767-228058789 GCCTTCCCAGGTCAGGGCTTGGG - Intronic
924451445 1:244182424-244182446 GGCTGCCCAGGGCTGAGCGTGGG - Intergenic
924708836 1:246518407-246518429 TCCATCCCAGGTCTCAGCTCGGG + Intergenic
1062989076 10:1798863-1798885 GCTTCCCCAGGGCTGTGCTTGGG - Intergenic
1064102477 10:12475653-12475675 CCCCTCCTAGGTCTGAGTTTGGG + Intronic
1067166669 10:43870896-43870918 GCCTCCCCAGGTCTATGCCTGGG + Intergenic
1067968726 10:50944209-50944231 GCCTGGCCAGGTCAGAGCTTTGG + Intergenic
1069775408 10:70924316-70924338 CTCTTCCCAGCTCTGAGCTCAGG + Intergenic
1069944875 10:71978912-71978934 GCCTCCCCATGTCTGACCTTGGG + Intronic
1072437471 10:95427361-95427383 GCCACACCAGGTCTGAGCGTTGG - Intronic
1073141200 10:101249178-101249200 CCCTTCCCAGCTCCCAGCTTAGG - Intergenic
1074816876 10:117148882-117148904 ACCTTCCCAGCTCTGAGCTCTGG - Intergenic
1076114201 10:127884175-127884197 GCCTTCCCATTACTGAGCTCGGG + Intronic
1076120686 10:127934720-127934742 GCCTTCCCCGCTCTGTGCCTGGG + Intronic
1076293318 10:129364670-129364692 GCCTTCACATGTCTGAGCTACGG + Intergenic
1076737401 10:132464981-132465003 GCCTTCCCAGGCCTGTGCCCAGG - Intergenic
1076853007 10:133102329-133102351 ACCTATCCAGGTCTGAGCTCAGG + Intronic
1076932971 10:133546097-133546119 GCCTTCACAGTTCTGTGCTTGGG - Intronic
1078015535 11:7610444-7610466 GCCTTCCCAGGTCTGAGCTTAGG - Intronic
1078070816 11:8108565-8108587 TCCTTAACTGGTCTGAGCTTTGG - Intronic
1078360708 11:10665548-10665570 GCCTATCCAGCTCTGAGCTGAGG - Intronic
1080644950 11:34181631-34181653 GTCTTCCCAGAGCTAAGCTTGGG - Intronic
1082028252 11:47587869-47587891 CCCTTCCCAACCCTGAGCTTAGG - Intronic
1083729584 11:64645525-64645547 CACTTCCCAGGGCTGAGATTTGG - Intronic
1084905276 11:72341299-72341321 GCCTTCCCAGGTTAGAGATCTGG + Intronic
1085326914 11:75613308-75613330 CCATCCCCAGGTGTGAGCTTTGG - Intronic
1089391743 11:118106925-118106947 GTCCTCCCAGGTCTGAGACTTGG + Intronic
1090395190 11:126414177-126414199 GCCTGGCCAGGTCTGAGATGAGG + Exonic
1091225713 11:133955814-133955836 GCTTTCCTGGGTCTGAGCTGGGG - Intronic
1091847957 12:3672022-3672044 TCCTTCCCTTCTCTGAGCTTTGG + Intronic
1093882857 12:24425472-24425494 CTCTTCCCAGGCCTGATCTTTGG + Intergenic
1096153062 12:49326501-49326523 GCCTTCACCTCTCTGAGCTTTGG + Intronic
1096237844 12:49942140-49942162 GCCTTCTTAGGGCTGAGCGTTGG - Intergenic
1096649018 12:53052925-53052947 GCCTTTCCAGGTATAAGCTGTGG + Intronic
1096693412 12:53334735-53334757 GCCTTCCCAACTCTGTGCCTTGG + Intronic
1097245958 12:57607652-57607674 GTTTTCCTAGGTCAGAGCTTGGG - Intronic
1097924538 12:65112794-65112816 GCCTTCCCAGGGAAGAGCTCAGG - Intronic
1098385508 12:69914678-69914700 GCCTTCCTAGGAATGAGCTTAGG - Intronic
1099007938 12:77257300-77257322 GCCTTCCCAGGTCTGTGATGTGG + Intergenic
1102554626 12:113718952-113718974 CCTTTCCCAGGGCTGAGCTTTGG + Intergenic
1102781898 12:115572758-115572780 GCCTTCCCAGGCCCAAGTTTTGG + Intergenic
1103001188 12:117386512-117386534 GACTGCCCTGGTCTGAGCTGGGG + Intronic
1103614911 12:122145843-122145865 GCCTTCCCACGTCAGAGCCAGGG - Exonic
1104131749 12:125900370-125900392 ACCTGCCCAGGGCTGAGTTTGGG + Intergenic
1104897503 12:132171526-132171548 GCCTTCCCAGGGCTGCACCTGGG - Intergenic
1106242082 13:27920512-27920534 GCCTTTCCACGCGTGAGCTTTGG - Exonic
1112751708 13:102589959-102589981 GCCTTCCCAGGCCAGAGATGGGG - Intergenic
1117773826 14:59162037-59162059 ACCTTCCCTGGGCTGAGCATGGG + Intergenic
1119060559 14:71469953-71469975 GCCTTGCCAGTCCTGAGCCTGGG + Intronic
1120765414 14:88323487-88323509 GCCTTCCCAGCTGGGAGCCTCGG - Intronic
1120827177 14:88966625-88966647 GACTTCCACGGTATGAGCTTGGG - Intergenic
1121911717 14:97797843-97797865 CCTTTCACAGGTCTGAGCCTTGG - Intergenic
1122337221 14:101001655-101001677 GCCTGCCCAGCTCTGAGCCTCGG + Intergenic
1122663069 14:103310816-103310838 ACCTTCCCAGGGCTCAGCTTGGG + Intergenic
1122689853 14:103527078-103527100 GCCTCCTCAGTGCTGAGCTTTGG + Intergenic
1122881960 14:104694195-104694217 GCCAACCCAGGTCAGAGCTACGG + Intronic
1123122470 14:105923756-105923778 GCCCTCCTGGGTCTGGGCTTGGG + Intronic
1202899829 14_GL000194v1_random:28571-28593 GCCTGCCCAGGTCTGTGTTGAGG - Intergenic
1123405116 15:20015180-20015202 GCCCTCCTGGGTCTGGGCTTGGG + Intergenic
1123514447 15:21021828-21021850 GCCCTCCTGGGTCTGGGCTTGGG + Intergenic
1125758754 15:42083380-42083402 GCTGTCCCAGGTCCGAGCTGGGG - Intronic
1127629828 15:60817699-60817721 GCCTTCCCATGTGTGGGCTGAGG + Intronic
1127653978 15:61038215-61038237 GCCTTCCCAGACTTGCGCTTTGG - Intronic
1130227942 15:82073886-82073908 GCCTTGCTAAGTCTGAGCTCAGG - Intergenic
1130918228 15:88322782-88322804 GCCCTCCCAGGCCTGAGCTTTGG - Intergenic
1132603299 16:783381-783403 GCCTGCCCACCTCTGAGCTGCGG - Intergenic
1133201167 16:4205550-4205572 GCCTCCCCAGGTCTCTGCTGGGG + Intronic
1133904494 16:10009530-10009552 GCCTTTCCTGGTCTGAGTCTAGG - Intronic
1134766208 16:16760436-16760458 TCCTTCACAGGTCTGTGCATAGG + Intergenic
1138488448 16:57361734-57361756 GCCTCCCCAGGTGTGAGATTTGG - Intronic
1139924105 16:70476355-70476377 GCCTTTCCAGGGCTGTGCTGGGG + Intronic
1142105123 16:88298479-88298501 GCCTTCCAGGGTCTCAGCCTGGG - Intergenic
1142661305 17:1431407-1431429 ACCTTCCCTGATCTGATCTTTGG - Intronic
1143300150 17:5902819-5902841 TCCTCCCCAGGGCTGGGCTTGGG + Intronic
1147215900 17:38898882-38898904 GCCTCCCCTGGTCTGCGCCTGGG + Intronic
1147966744 17:44198310-44198332 TCTTTCCCAGGCCTGAGCTCAGG + Intronic
1148136277 17:45293958-45293980 GCCTTCCCAGCCCTGGACTTTGG + Intronic
1148186287 17:45646577-45646599 GGCTTCCCAGGTTTCACCTTTGG - Intergenic
1149602630 17:57903177-57903199 GCCTGCCCAGCTCAGAGCTGAGG - Intronic
1149867637 17:60159491-60159513 GCCTTCCCAGGTGGGACTTTAGG + Exonic
1151282978 17:73090230-73090252 CCCTTCCTAGGTTTGAGCCTGGG - Intronic
1151391776 17:73791962-73791984 GCCTTCCCAGCTCAGACCCTTGG - Intergenic
1152291037 17:79440471-79440493 GGCTCCCCTGGTCTGGGCTTCGG - Intronic
1152582668 17:81173503-81173525 GGCTTTCCAGCTGTGAGCTTGGG - Intergenic
1152656960 17:81524224-81524246 GCCTCCCGAGGCCTGAGCCTCGG - Intergenic
1152947731 17:83207054-83207076 GCCTCCCCAGGGCTGGGCTGTGG - Intergenic
1154199225 18:12287782-12287804 CCCCTCCCAGGAATGAGCTTTGG + Intergenic
1154486860 18:14878996-14879018 GCCTGCCCAGGTCTGTGCTGAGG - Intergenic
1154499068 18:14985455-14985477 GCCTCCCCAGGTCTGTGCAGAGG + Intergenic
1159458545 18:68693759-68693781 GCCTTCCCTGGCCTGAAGTTGGG - Intronic
1159547875 18:69863396-69863418 GCCATCCCAGGTCTAGCCTTAGG - Exonic
1160533828 18:79580759-79580781 GCCTTCCTCGATCTGAGCTCGGG + Intergenic
1160966163 19:1747894-1747916 GCCTCCCCAGTTCTGATCTCAGG + Intergenic
1161398887 19:4059013-4059035 GGCTTCCCAGGGCCGAGCCTTGG - Intronic
1161583239 19:5091994-5092016 CCCTTCCCATGTGTGGGCTTAGG + Intronic
1162129093 19:8514381-8514403 GCCTGTCCAGGGCTGATCTTGGG - Intergenic
1162503246 19:11066713-11066735 GGCTACACAGATCTGAGCTTGGG + Intergenic
1162725817 19:12689278-12689300 CCCTTCCCAGGTCTGTGCTGAGG - Exonic
1165372552 19:35418492-35418514 CCTTTCCCAGGTGAGAGCTTAGG - Intergenic
1166546027 19:43635378-43635400 GCCTTCACAAGGCTGAGCTGGGG - Intronic
1167823091 19:51947960-51947982 GGCTTCCCAGGCCTGTCCTTGGG + Intronic
1168308228 19:55447716-55447738 GCTCTCCCAGGTCTGTGGTTTGG - Intergenic
1168714226 19:58517868-58517890 GCCTGGCCAGGTCTGAGGTAGGG - Intronic
926956180 2:18303304-18303326 GGCTTCCCAGGCCTGAGCATAGG - Intronic
927870463 2:26619792-26619814 GCCTTCCCCGCTGTGGGCTTTGG - Intronic
927870518 2:26620044-26620066 GCCTTCCCCGCTGTGGGCTTCGG - Intronic
928216648 2:29367020-29367042 CGCTTCCCTGGGCTGAGCTTGGG + Intronic
928305832 2:30169707-30169729 GCCCTCCCAGGTGTAGGCTTGGG - Intergenic
928854370 2:35786959-35786981 GCCTTCCCAGGTAGGTGATTTGG + Intergenic
929584475 2:43105196-43105218 CCCTTCCCAGGGCTGACCTGGGG - Intergenic
933713502 2:85344249-85344271 GTCCTCCCAGGTCGGATCTTTGG + Exonic
933721849 2:85402000-85402022 GCCTGCCCAGGGCTGTGCTTGGG - Intronic
934941149 2:98503105-98503127 GCTTTGCCAGGTCTGAGCAGGGG + Intronic
937556967 2:123170107-123170129 CCTTTCCCACTTCTGAGCTTTGG - Intergenic
938737397 2:134198735-134198757 ACCTTCTCAGGTCTGATCATGGG + Intronic
943708483 2:191061588-191061610 GTGTGCCCAGCTCTGAGCTTGGG - Intronic
945126785 2:206520785-206520807 GCCTTCCAAGTTCTGAGTTCTGG + Intronic
945971209 2:216233874-216233896 TCCTTCCAGGGTCTGAGGTTAGG - Intergenic
946040124 2:216775995-216776017 CCCCTCCCATGTCTTAGCTTTGG + Intergenic
946153794 2:217793889-217793911 CCCTTCCCAGGTCTGGCCCTGGG - Intergenic
946192959 2:218017081-218017103 CCCTTCCGTGGTCTGAGCCTGGG - Intergenic
948869879 2:240792460-240792482 GCCTTCCCAGGACTCTGCATGGG + Intronic
948902260 2:240962758-240962780 TGCCTCCCAGGTCTGAGCTCTGG - Intronic
948909991 2:240998227-240998249 CCCTTCCCAGCCCTGAGCATGGG - Intergenic
1171156440 20:22878846-22878868 TCATTCCCAGGTCTGATTTTAGG - Intergenic
1172282785 20:33719902-33719924 GCCTTCCCAGCTCTGAACTGGGG - Intronic
1172571268 20:35972836-35972858 TCTTTCTCAGTTCTGAGCTTAGG - Intronic
1174157231 20:48523634-48523656 GCTTTCCCATGGATGAGCTTGGG - Intergenic
1174272797 20:49381716-49381738 GCCTGTCCAGGCCTGAGCTGGGG - Intronic
1175765300 20:61588282-61588304 GCCTTCCTAGTTCTTAGATTTGG - Intronic
1175979889 20:62733274-62733296 GCCTTCCCAGAGCTGTGCCTGGG - Intronic
1176083953 20:63287445-63287467 GCCTTCCCAGGCCAGCGCTCAGG - Intronic
1176416511 21:6478630-6478652 CCCTTCCCACGACTCAGCTTAGG + Intergenic
1176619203 21:9043345-9043367 GCCTGCCCAGGTCTGTGTTGAGG - Intergenic
1176794426 21:13360338-13360360 GCCCGCCCAGGTCTGTGCTGAGG + Intergenic
1179274357 21:39878224-39878246 TCCTTCCCAGCTCTGAGCAATGG - Intronic
1179595483 21:42440231-42440253 GCCTTTCCAGCTCTGCGCTTTGG + Intronic
1179640669 21:42745544-42745566 GCCTTGCCAGGTCCCAGCCTTGG - Intronic
1179692011 21:43086965-43086987 CCCTTCCCACGACTCAGCTTAGG + Intergenic
1181049272 22:20231050-20231072 GCTTCCCCAGGCCTGAGCTTGGG + Intergenic
1181510522 22:23386860-23386882 GCCTTCCCATGTCAGAGGTGAGG - Intergenic
1181549854 22:23631675-23631697 GCTTTCCCAGGTCTGGGCATGGG - Intronic
1181798538 22:25327857-25327879 GCTTTCCCAGGTCTGGGCATGGG + Intergenic
1183005559 22:34898692-34898714 GCCATTCCAGGTATGAGCTATGG + Intergenic
1183525148 22:38318174-38318196 CACCTCCCAGCTCTGAGCTTGGG + Intronic
1183813140 22:40275032-40275054 GCCTTCCCATGTCTGAGGATTGG + Intronic
1183952096 22:41357757-41357779 GGCTCCCCAGCCCTGAGCTTTGG - Exonic
1184091157 22:42293653-42293675 GCCTCCCCAGGCCTGCCCTTAGG - Intronic
1185387978 22:50545141-50545163 GCCTTCCCTTATCTGAGCTGAGG - Intergenic
949941559 3:9158838-9158860 GCCTTCCCATGCCTGAGTTGTGG - Intronic
950262818 3:11554634-11554656 GCCTTGGCAAGTCTGAGATTTGG + Intronic
950469662 3:13176682-13176704 CCCTTGCCAGCTCTGTGCTTTGG - Intergenic
950684052 3:14603736-14603758 TCCTTCCCAGGACAGAGCTGAGG - Intergenic
951943467 3:28108538-28108560 TACTTCCCAGCTTTGAGCTTGGG + Intergenic
952569414 3:34696375-34696397 TCATTCCCAGGGCTGATCTTAGG - Intergenic
952875580 3:37941747-37941769 GCCTGCCCCGGGCTGAGCCTTGG + Intronic
952923691 3:38306624-38306646 GGCTTCCCATCTCTGAGCTTCGG - Intronic
953784915 3:45904082-45904104 GCCTTCCCAGGTGGGAGCCTGGG + Intronic
954456970 3:50604886-50604908 CCCTTCCCTGCTCTGAGCCTCGG + Intergenic
955448425 3:59038859-59038881 GCTGTCCAAGGTCTGAGCTTAGG - Intronic
959591837 3:108090707-108090729 GCCCTCCCACGTCTGCACTTCGG + Intronic
960960664 3:123068046-123068068 GCCGGCCCAGGTCTGGGGTTTGG + Intronic
961150919 3:124637107-124637129 CCCTTCCCTGGCTTGAGCTTTGG + Intronic
961439649 3:126945274-126945296 GCCCTTCCAGCTCTGTGCTTTGG - Intronic
961782884 3:129331462-129331484 GGCTGCCCAGGGCTGAGCTCTGG + Intergenic
968898945 4:3421752-3421774 GCCCACCCAGGTCTGGGCTGGGG + Intronic
972360240 4:38319935-38319957 GCCATCCCAGGACCGAGCTGGGG + Intergenic
975697350 4:77026446-77026468 GCCTCTCCAGGACTGAACTTCGG + Intronic
977524412 4:98126342-98126364 GCCTGCACAGCTCTGTGCTTGGG + Intronic
978214007 4:106175531-106175553 GCCTTCCCAGATATGACCATAGG + Intronic
981732885 4:147918604-147918626 GCCATCCCTGGTCTGGACTTAGG + Intronic
984656314 4:182322429-182322451 ACCTTCCCAGGTCTGGGCTGTGG + Intronic
985301639 4:188496383-188496405 GCCCTCCCAGCTCTGAGCTTTGG + Intergenic
985542918 5:495110-495132 TGCTTCCCAGGTCTGACCTGCGG - Intronic
985861171 5:2471659-2471681 TCCTTCCCAGCCCTGACCTTTGG - Intergenic
986606916 5:9531756-9531778 GTCTTCCCAGGGCAGAGCCTAGG + Intronic
988702320 5:33687693-33687715 GCCTTAACAGGACTGAGCTGGGG + Intronic
989541532 5:42624262-42624284 GCATTTCCAGGCCAGAGCTTTGG + Intronic
990243463 5:53838589-53838611 GCCTTCCAAAGTCTGCACTTCGG - Intergenic
996933781 5:128924395-128924417 GACCTCCCAGGGCTGAGCTAAGG - Intronic
998060513 5:139115162-139115184 CCCTCCCCAGGTCTGTGGTTGGG - Intronic
999518892 5:152330161-152330183 GCCCTCCTAGCTGTGAGCTTTGG + Intergenic
1000189120 5:158891536-158891558 ACTTTCCCAGGTCTCAACTTTGG + Intronic
1000911186 5:167024516-167024538 GCCTTCCCAGCCCTGACCCTTGG - Intergenic
1001050264 5:168408453-168408475 GCCTTCCCAGGAGGGAGCTCTGG - Intronic
1001685981 5:173595473-173595495 GTCTTACCAGCTCTGAGATTTGG + Intergenic
1001740723 5:174050895-174050917 GCCTCCCCAGGGCTGTGCCTTGG + Intronic
1001796921 5:174510010-174510032 GGCTTCCCAGGGCTGATCATGGG - Intergenic
1002183715 5:177444237-177444259 ACCTGCCCAGGGCTGGGCTTTGG - Intergenic
1002311302 5:178315474-178315496 GCCTGACCAGCTCTGAGCCTTGG - Intronic
1002741895 5:181440208-181440230 GCCTCCCCAGGGCTGGGCTGTGG - Intergenic
1003107442 6:3227398-3227420 GCCTTCCCAGGACCGCGCCTGGG + Intronic
1003370596 6:5522241-5522263 CCCCTTCCAGGTCTGGGCTTGGG - Intronic
1003520457 6:6854210-6854232 TACTTCCCAGTTCTGTGCTTAGG - Intergenic
1007729397 6:43936743-43936765 GCCTGGACAGGGCTGAGCTTGGG + Intergenic
1008082577 6:47209729-47209751 GCCTGCACAGCTCTGGGCTTCGG - Intergenic
1008298363 6:49805184-49805206 GTCTGCCCAGCTCTGTGCTTTGG - Intergenic
1008428649 6:51388886-51388908 ACCTTCCCATGACTGAGCTGTGG + Intergenic
1009809302 6:68639890-68639912 CCATTTCCAGGTCTGATCTTGGG + Intronic
1013108510 6:107046627-107046649 GCCTTCCCTGGTCTGCTCTGTGG + Intronic
1013426616 6:110018235-110018257 GTGTTCCCAGTTCTGAGCTAAGG - Intergenic
1015587315 6:134789419-134789441 GTCTTCACAGCTCTGTGCTTGGG - Intergenic
1015933905 6:138389318-138389340 GGCTTCCCAGATCTGTGGTTTGG - Intergenic
1017915956 6:158831825-158831847 GCCATCAGAGTTCTGAGCTTCGG - Intergenic
1018000345 6:159573114-159573136 GCCGTCCCAGCTCTGAGATGAGG + Intergenic
1018663060 6:166106066-166106088 GCCTTCCCAGGAGTGGGGTTGGG - Intergenic
1018746183 6:166764192-166764214 GTCTTCCCAGCTCTGAGCTGGGG - Intronic
1019247036 6:170715965-170715987 GCCTCCCCAGGGCTGGGCTGTGG - Intergenic
1019602095 7:1889872-1889894 GGCCCCCCAGCTCTGAGCTTTGG - Intronic
1022824532 7:33995529-33995551 GCCTTTCCATTTCTGAGCTTAGG - Intronic
1027482067 7:78710342-78710364 GGATTCCCAGGTCTTAGCATAGG + Intronic
1027715757 7:81668087-81668109 GTGTTCCCAGTTCTGAGCTAGGG + Intergenic
1031689204 7:124766324-124766346 GCATGCCCAGGTCTCAGCTCTGG + Intergenic
1033011868 7:137631801-137631823 GCCTGCCTAGTTCTGAGATTTGG - Intronic
1035501105 8:91988-92010 GCCTCCCCAGGGCTGGGCTGTGG + Intergenic
1036638393 8:10566834-10566856 GCCTTCTTAGCTCTGATCTTGGG - Intergenic
1037165448 8:15822613-15822635 GGCTTCCAAGGATTGAGCTTTGG + Intergenic
1037728760 8:21506038-21506060 GCCTTCCAAGGGCTGTGCTGCGG + Intergenic
1042961772 8:74310982-74311004 GCCTTTCCAGATCTGAAATTGGG + Intronic
1046072184 8:109269511-109269533 GGCTTACCAGGTCTGAGTTCTGG - Intronic
1046228382 8:111317163-111317185 GCTTCCCCTAGTCTGAGCTTTGG - Intergenic
1049478486 8:142807877-142807899 ACCTTCCCAGGCCTGGGCTGAGG - Intergenic
1049761361 8:144333189-144333211 GCCTGCACAGGGCTGAGCTGTGG + Exonic
1052855417 9:33403502-33403524 CCATTCCCAGACCTGAGCTTTGG - Intergenic
1053301126 9:36950409-36950431 TCCCTTCCAGCTCTGAGCTTTGG - Intronic
1053762610 9:41356818-41356840 GCCCTCCCGGGTCTGTGCTGAGG + Intergenic
1057131901 9:92659926-92659948 GCTTCCCCAGGTCTCAGCTTGGG - Intronic
1057476773 9:95409611-95409633 CCCTTACCAGCTGTGAGCTTAGG - Intergenic
1060660929 9:125404938-125404960 GCCTTCGCTGCTCTGAGCCTTGG - Intergenic
1060856853 9:126920948-126920970 GTCTTCCCAGCTCTGAGTCTTGG + Intronic
1060976899 9:127770315-127770337 GCCATCCCAGGCCTAAGCTGGGG - Intronic
1061918595 9:133769951-133769973 GCCTTCCCTGTTCTGAGCTGTGG + Intronic
1062421980 9:136487042-136487064 GCCTTCCCAGGGCTGACATGAGG + Intergenic
1203607807 Un_KI270748v1:71424-71446 GCCTCCCCAGGGCTGGGCTGTGG - Intergenic
1185947006 X:4387979-4388001 CCCTTACCTGGTGTGAGCTTGGG + Intergenic
1187004322 X:15216985-15217007 GCCTTCAAAGTTCTGGGCTTTGG - Intergenic
1187983267 X:24782511-24782533 GGCTTCCAAATTCTGAGCTTAGG + Intronic
1192146939 X:68688554-68688576 GCCTTCCCAGGTTTTTTCTTTGG + Intronic
1192434997 X:71137626-71137648 GACTTCCCAGGTAAGAGCCTGGG + Exonic
1193067346 X:77274535-77274557 GCCTTCCCAACTCTGAGCCCAGG + Intergenic
1193533679 X:82686835-82686857 ACCTGCCCAGCTCTGTGCTTGGG + Intergenic
1193895517 X:87110291-87110313 GCCTGCACAGCTCTGTGCTTGGG - Intergenic
1195616725 X:106918340-106918362 GACTCCCCAGGCCTGAGCTCAGG + Intronic
1201152868 Y:11103330-11103352 GCCTGCCCAGGTCTGTGCTGAGG - Intergenic