ID: 1078015765

View in Genome Browser
Species Human (GRCh38)
Location 11:7613034-7613056
Sequence CAGTGAGTGTATTTAGCCTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 116
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 108}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078015762_1078015765 4 Left 1078015762 11:7613007-7613029 CCCATACTATACTGCTGCTGTTT 0: 1
1: 0
2: 2
3: 11
4: 156
Right 1078015765 11:7613034-7613056 CAGTGAGTGTATTTAGCCTAAGG 0: 1
1: 0
2: 1
3: 6
4: 108
1078015763_1078015765 3 Left 1078015763 11:7613008-7613030 CCATACTATACTGCTGCTGTTTT 0: 1
1: 0
2: 1
3: 26
4: 195
Right 1078015765 11:7613034-7613056 CAGTGAGTGTATTTAGCCTAAGG 0: 1
1: 0
2: 1
3: 6
4: 108

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078015765 Original CRISPR CAGTGAGTGTATTTAGCCTA AGG Intronic
901518271 1:9764032-9764054 CAGTGAGTGGAAGTAGCCTGAGG - Intronic
906030992 1:42720001-42720023 CAGGGAGTGTAATTAACCAAGGG + Intergenic
907906991 1:58791453-58791475 CAGTGAGTGTATACATCCTTTGG + Intergenic
909849506 1:80442641-80442663 CCGTGAGTGGATGTAGCCTGAGG - Intergenic
909933540 1:81525705-81525727 TAGTGAGAGTATTTATCCCAAGG + Intronic
910811148 1:91238011-91238033 CTGTGAGTAAATTTAGGCTATGG + Intergenic
912671077 1:111625495-111625517 CAGTGAGTGAATTTACTCTCTGG - Intronic
915015215 1:152726589-152726611 CCGTGTGTGTGTTTATCCTATGG + Intergenic
915027048 1:152840978-152841000 CAGGAAGTGTAGTTTGCCTAGGG + Intergenic
917552716 1:176051872-176051894 CAATGTGTGTTTTTAGCCAAGGG + Intronic
920840456 1:209549589-209549611 CATTGAGTGTATTTAGGAAATGG - Intergenic
922174457 1:223185975-223185997 AAGTGCATGTATTTTGCCTATGG - Intergenic
923629482 1:235640479-235640501 CAGTCTGTGTATAAAGCCTAAGG - Intronic
1064620547 10:17212340-17212362 AAATGAGTATATTTTGCCTAAGG + Intergenic
1065033651 10:21614410-21614432 AAGTGATGGTATTTAGCCCATGG - Intronic
1065991726 10:31016924-31016946 CAGTTACTGGATTTAGCTTAAGG + Intronic
1066517911 10:36184576-36184598 CAGTGAGTGTGTTGGGACTAGGG - Intergenic
1076826331 10:132971446-132971468 CAGTGTGTTTACTTAGTCTAAGG - Intergenic
1078015765 11:7613034-7613056 CAGTGAGTGTATTTAGCCTAAGG + Intronic
1078149344 11:8745447-8745469 GAGTGAGTGTATTTTGCATCTGG + Intronic
1079875350 11:25849149-25849171 CATTGAGTTTATTTTCCCTAGGG - Intergenic
1079966908 11:26991167-26991189 TTGTGAGAGTATTTAGACTAAGG + Intergenic
1080280333 11:30549816-30549838 AAGTGAGTGTACTTAGCTAAAGG + Intronic
1080507793 11:32934707-32934729 CAGAGAGTGAATTTACCTTAGGG + Exonic
1088183043 11:107133746-107133768 AAGTGAGTTTGTTTTGCCTATGG + Intergenic
1093453595 12:19342320-19342342 CAGTTAGTGTATTTAACCTGAGG + Intronic
1093638660 12:21501043-21501065 GAGAGAGAGGATTTAGCCTATGG - Intronic
1100689326 12:97023193-97023215 CAGTCATTGTGATTAGCCTATGG + Intergenic
1101131353 12:101694348-101694370 TACTGTGTGTATTTTGCCTATGG + Intergenic
1105618044 13:22039071-22039093 CAGTAAGTGTATATAGACTTGGG - Intergenic
1107716277 13:43202562-43202584 GAGAGAGTGTATTTTACCTATGG - Intergenic
1108317698 13:49253877-49253899 CAGTGAGGGCCTTTAGCATAAGG - Intronic
1109115459 13:58376804-58376826 CTGTAATTGTTTTTAGCCTAAGG - Intergenic
1110084957 13:71365849-71365871 AAATAAGTGTATTTAGCTTATGG + Intergenic
1110722479 13:78779901-78779923 CACTGAGTCAATTTAACCTAGGG - Intergenic
1111603983 13:90513375-90513397 CAGTGAGTGTTTCTAGTATATGG + Intergenic
1117576965 14:57108739-57108761 TATTGAGTGTTTTTAGCATAAGG - Intergenic
1118377037 14:65186497-65186519 CAGAGAATTTAATTAGCCTAAGG + Intergenic
1118838982 14:69497078-69497100 CAGTGACTGTATTCAGACCATGG + Intronic
1121938322 14:98042385-98042407 CAGTAAGTGTGTTTATCCAAAGG - Intergenic
1125222647 15:37357132-37357154 CACTGAGTGTATCTTGCCAATGG + Intergenic
1125369548 15:38957193-38957215 CAGTGGGAGTATTTACACTATGG + Intergenic
1127346946 15:58110509-58110531 AAGTGAGATTATTTAGCCTATGG - Intronic
1137319668 16:47367821-47367843 TAGTAAGTGTATTAAGCCTCAGG + Intronic
1138050144 16:53767952-53767974 CAGTGAGTTAATATAGGCTAAGG + Intronic
1138054901 16:53822484-53822506 CAGTGAGAGTATTTACACTGCGG - Intronic
1143537172 17:7548579-7548601 CAGTGAGTGTTTTAAGCTGAAGG + Intergenic
1143946679 17:10598822-10598844 GAGTGAGTGAATATAGCATATGG + Intergenic
1145010175 17:19363545-19363567 CAGTGAGGGTTGTTAGCCTCTGG - Intronic
1149442648 17:56687972-56687994 GAGTGAGTGTATTTTGCATGTGG + Intergenic
1149452761 17:56762747-56762769 CAGTGAGTGTATTTTGCGTGTGG - Intergenic
1151768656 17:76145554-76145576 CAGTGACTGTACCTAGCCCAGGG - Intronic
1155755508 18:29490049-29490071 TAGTGAGTGTATTTTGCATGTGG - Intergenic
1157442272 18:47720001-47720023 CAGTGAGGGTATTTACACCATGG - Intergenic
1157757640 18:50232652-50232674 CAGAGAGCCTATTTAGCATAAGG - Intronic
926528431 2:14011399-14011421 CGGTGAGGGTATTTACACTACGG + Intergenic
927753825 2:25692932-25692954 CAGTGAGTGTGTTTAGCATGTGG + Intergenic
928669565 2:33587466-33587488 CAGTGAGTGTCTTTATCTTGTGG - Intronic
929830326 2:45342148-45342170 GAGTGAGTGTGTTAAGCCCAGGG + Intergenic
931211727 2:60203516-60203538 TATTGAGTGTTTTTAGCCTGAGG + Intergenic
933537119 2:83589770-83589792 CATTGAGATTATCTAGCCTATGG + Intergenic
933722784 2:85409106-85409128 CAGGAAGTGTATTTTGCCTCTGG + Intronic
936836457 2:116716289-116716311 CAGTGAGTATAAATAGACTAGGG + Intergenic
937942941 2:127302306-127302328 CAGTGAGTGTAGTCATCCTTGGG - Exonic
939521218 2:143232949-143232971 CTGTTAGTATAGTTAGCCTAGGG + Intronic
943093251 2:183398827-183398849 CATTGAGCGTATTTAGACTTTGG + Intergenic
946158977 2:217824620-217824642 CAGTGAGTGTCTTTAGTCTTGGG + Intronic
1168990261 20:2088995-2089017 CAGTGAGAGTATTCACACTATGG - Intergenic
1169575517 20:6955842-6955864 CAGAGAATGTAGTTAGCCTGGGG + Intergenic
955299723 3:57765948-57765970 CAAAGAGTGAATTTAACCTAAGG - Intronic
955469344 3:59270004-59270026 CAGTGAGTGTATTTTCCATGTGG - Intergenic
962948752 3:140198806-140198828 CAGTGGCTGAATTTAGCCTGTGG + Intronic
965008687 3:163057942-163057964 CAGTGACTGGACTTAGTCTAAGG + Intergenic
965789482 3:172372424-172372446 CAGTGACTTTATTGAGCATATGG + Intronic
968359797 3:198138895-198138917 TAATGAGTGTATTTGGCCAATGG + Intergenic
968643044 4:1724301-1724323 CACTGAGTGTATGCAGCATATGG + Intronic
972049974 4:34718481-34718503 AAGGGAATGCATTTAGCCTAGGG - Intergenic
975844524 4:78511070-78511092 CAGTGAGTACTTATAGCCTAAGG - Intronic
979919295 4:126478389-126478411 CTGTGTCTGTTTTTAGCCTAGGG - Intergenic
980030854 4:127828192-127828214 CAGTGGCTGGATTTAGCCGATGG + Intronic
980838865 4:138232451-138232473 CCTTGAGTGTATTTAGCATATGG + Intronic
983593167 4:169437366-169437388 GTGTGAGTGTATTTTGCATATGG + Intronic
983659079 4:170114071-170114093 TAGTGAGTGTATCTATCTTATGG + Intergenic
993634302 5:90325890-90325912 CAGTCAGTGCATTTGGCCCAGGG + Intergenic
995897778 5:117034579-117034601 CAGTGTGTGCACTTAGCCTCTGG + Intergenic
999807476 5:155096277-155096299 TAGTGTGTGGATTTAGCCCATGG + Intergenic
1001946452 5:175782400-175782422 AAGTGAGTATATTTTGCATATGG + Intergenic
1002993023 6:2255446-2255468 AGGTGAGTGTATTTTGCATAAGG - Intergenic
1004902776 6:20209542-20209564 CTGTGAATGTCTTTAGCCTCTGG - Intronic
1007949177 6:45854945-45854967 GAGTGAGTGAATTTTGCCTTGGG - Intergenic
1010042084 6:71396805-71396827 CAGTGTGTGTATTTGGGATACGG - Intergenic
1016661594 6:146587422-146587444 CAGTGAGTGTTATTAGAATAAGG + Intergenic
1019260191 7:77753-77775 TAATGAGTGTATTTGGCCAATGG - Intergenic
1020986207 7:15137772-15137794 CAGTGAATGTTTTTAAGCTAGGG + Intergenic
1022251237 7:28610522-28610544 CATTGGGTTTATTTAGCCTGGGG - Intronic
1026032390 7:66805588-66805610 CAGAGATTGTGTTTATCCTACGG + Intronic
1027538585 7:79438884-79438906 CAGTGAATGTGTTTAGGCGAAGG - Intronic
1027581841 7:80006411-80006433 CAGTGAGTGAATTGAGGCAATGG + Intergenic
1028473124 7:91225774-91225796 CAGTGAGTGTATTTTGCATATGG - Intergenic
1030420017 7:109297543-109297565 AAATGAGTTTATTTATCCTATGG + Intergenic
1033878994 7:145858275-145858297 TACTGAGTGTATTTTGACTAGGG - Intergenic
1038539733 8:28382315-28382337 CAGGGAGTGTTTTAAGCATATGG - Intronic
1041938171 8:63357746-63357768 CAGTAAGCTTATTTAGCCTTTGG + Intergenic
1043430743 8:80192153-80192175 CAGTGAGAGTATTTACACCATGG + Intronic
1043913984 8:85898810-85898832 AAGAGAGTGTATTTATCCTGTGG - Intergenic
1044155562 8:88841660-88841682 CACTGAGTATATTTTGCATATGG + Intergenic
1045769201 8:105714734-105714756 TAGTGAGAGTATTTACACTATGG + Intronic
1056043883 9:82696070-82696092 CAGGGAGGGTATAGAGCCTAGGG + Intergenic
1056498667 9:87186460-87186482 CAGGCAGTGTTTTTAGCCTGAGG + Intergenic
1059760831 9:117336015-117336037 CAGTGAGTGTAGGCAGCTTAAGG + Intronic
1060149320 9:121277946-121277968 CAGAGAGGGTGTGTAGCCTATGG + Intronic
1062744500 9:138202716-138202738 TAATGAGTGTATTTGGCCAATGG + Intergenic
1188450533 X:30303627-30303649 TAATGAGTGTATCTAGTCTAGGG - Intergenic
1192133079 X:68571142-68571164 GAGTGAGTGTACTTTGCATATGG + Intergenic
1194755580 X:97734733-97734755 GAGTGAGTGTATTTTTCATATGG + Intergenic
1201720023 Y:17086027-17086049 CAGAAAGTGTGTTTGGCCTAAGG + Intergenic