ID: 1078016218

View in Genome Browser
Species Human (GRCh38)
Location 11:7617326-7617348
Sequence GCGTGTGTGGGGCATTTCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 90
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 82}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078016213_1078016218 11 Left 1078016213 11:7617292-7617314 CCTGTAGGAACCACACTTAAGTA 0: 1
1: 0
2: 2
3: 8
4: 87
Right 1078016218 11:7617326-7617348 GCGTGTGTGGGGCATTTCACTGG 0: 1
1: 0
2: 0
3: 7
4: 82
1078016211_1078016218 28 Left 1078016211 11:7617275-7617297 CCTGTTGGGAGGGGTCACCTGTA 0: 1
1: 0
2: 0
3: 4
4: 98
Right 1078016218 11:7617326-7617348 GCGTGTGTGGGGCATTTCACTGG 0: 1
1: 0
2: 0
3: 7
4: 82
1078016214_1078016218 1 Left 1078016214 11:7617302-7617324 CCACACTTAAGTATATCAGAGCA 0: 1
1: 0
2: 0
3: 9
4: 113
Right 1078016218 11:7617326-7617348 GCGTGTGTGGGGCATTTCACTGG 0: 1
1: 0
2: 0
3: 7
4: 82

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078016218 Original CRISPR GCGTGTGTGGGGCATTTCAC TGG Intronic
900778257 1:4600523-4600545 CAGCGTGTGGAGCATTTCACCGG + Intergenic
901863226 1:12087914-12087936 TGGTGGGTGGGGCATTTTACTGG + Intronic
905825672 1:41024288-41024310 GGGAGTGTGGGGCATTTTTCTGG - Intergenic
923828261 1:237524333-237524355 GCCTGTTTTGGGCATTTCATAGG - Intronic
924587000 1:245368753-245368775 GAGTGTGTGGAGGATCTCACAGG + Intronic
1068608917 10:59037096-59037118 GCATGTTTGGGGCATTTTAGTGG + Intergenic
1070517060 10:77218074-77218096 GCGTGGGTGGGGAAGTTCAGAGG + Intronic
1072968500 10:99995602-99995624 GCTTGTTGGGGGCATTTCATGGG + Intronic
1073619080 10:105028468-105028490 TCTTGGGTGGGCCATTTCACGGG - Intronic
1076879997 10:133235527-133235549 GCGTGCGGGGCGCAATTCACGGG + Intergenic
1078016218 11:7617326-7617348 GCGTGTGTGGGGCATTTCACTGG + Intronic
1081669202 11:44933824-44933846 ACGTGTGGGGGGCAGCTCACCGG + Exonic
1084090278 11:66875178-66875200 GCATGTCTGGGGCAATTCAGAGG + Intronic
1084626227 11:70309776-70309798 GCCTGTTTCGGACATTTCACAGG - Intronic
1089593115 11:119557616-119557638 GAGAATGTGGGACATTTCACAGG + Intergenic
1091667297 12:2428537-2428559 CCGTGTGTGTGGCATCTCAAAGG + Intronic
1104743402 12:131194955-131194977 GTGTGTCTGGGTCTTTTCACAGG - Intergenic
1104790931 12:131481729-131481751 GTGTGTCTGGGTCTTTTCACAGG + Intergenic
1113418985 13:110155233-110155255 GCGTGAGTGGGGCTCTTCCCGGG + Intronic
1121178347 14:91907833-91907855 GTGTGTGGGGGGCATCTCACTGG - Intronic
1122957374 14:105076946-105076968 GCGGGTGGGGGGCATTTACCAGG + Intergenic
1128537905 15:68504452-68504474 GAGTGTGTGGGGCACTTTCCTGG - Intergenic
1130910150 15:88265234-88265256 GGGAGTGTGGGGCTTGTCACTGG - Intergenic
1134524267 16:14932231-14932253 GGGTGTGTGGTGCAGGTCACCGG + Intronic
1134711856 16:16330718-16330740 GGGTGTGTGGTGCAGGTCACCGG + Intergenic
1134954972 16:18377976-18377998 GGGTGTGTGGTGCAGGTCACCGG - Intergenic
1136318607 16:29468079-29468101 GCGGGTCTGGGGCTTTTTACTGG + Intergenic
1136375949 16:29865018-29865040 GGGTGAGAGGGGCATTTCACAGG - Intergenic
1136433179 16:30207425-30207447 GCGGGTCTGGGGCTTTTTACTGG + Intronic
1141413254 16:83850831-83850853 GGGTGTGTGGGGGAGGTCACAGG - Intergenic
1150523377 17:65893157-65893179 GAGTGTGTGTGTCGTTTCACTGG - Intronic
1151842061 17:76625918-76625940 GGGGGTTTGGGGCATTTCACAGG - Exonic
1152607611 17:81300677-81300699 GCGTGTGTGTGGCATTTGTGGGG + Intergenic
1158835520 18:61327541-61327563 TCGAGAGTGGGACATTTCACAGG - Intergenic
1159324866 18:66901781-66901803 GTGTGTATGGGGGATTTCATGGG + Intergenic
1159632256 18:70762783-70762805 GCGTGGGTGGCTCATTTTACAGG - Intergenic
1160371238 18:78373352-78373374 GCGTGTCTGTGCCATGTCACGGG - Intergenic
1165330312 19:35138319-35138341 GTGTGTGTGGTGCATTTCTGGGG + Intronic
927558734 2:24053928-24053950 ACGTGTGTGGTGCACTACACAGG + Exonic
931390731 2:61841333-61841355 TCGTGTGTGAGGAACTTCACAGG - Intronic
932465741 2:71922937-71922959 GCATGGGTGGTGCATTTCAGGGG + Intergenic
933255672 2:80078309-80078331 GCGGGAGAGGGGCATTTAACTGG + Intronic
938276939 2:130035133-130035155 GTGTGTGTGCTGCAGTTCACAGG - Intergenic
939659833 2:144875049-144875071 GTGTGTCTGGGGCATTACTCTGG + Intergenic
942669980 2:178364704-178364726 GTGTCTGTGGGGCATTTTACAGG + Intronic
946048350 2:216840024-216840046 CCGTATGTGCTGCATTTCACTGG + Intergenic
946130363 2:217601812-217601834 AAGTGTGTGGGGCCTTTCTCAGG - Intronic
1172591534 20:36121556-36121578 GCATTTGTGGGGCATTTGCCTGG + Intronic
1178878841 21:36432783-36432805 GCCCGTGTGGGGCTTTGCACAGG + Intergenic
1179936402 21:44607827-44607849 GAGTGTGTGGGGCATGTGAAGGG - Intronic
1180874398 22:19168455-19168477 GAGTGAGTGGGGCATTTACCTGG - Intergenic
1181542498 22:23580695-23580717 GGGTCTGTGGAGCATCTCACTGG + Intergenic
1181778529 22:25177028-25177050 GCTTGTGTGGTGGATGTCACTGG + Intronic
959556778 3:107728825-107728847 GTGGGTGTTGGGGATTTCACAGG - Exonic
959777734 3:110188536-110188558 GAGTGTCTGAGGCATTTCCCTGG + Intergenic
961611822 3:128145578-128145600 GTGTGTGTGCAGGATTTCACAGG + Intronic
965114513 3:164470640-164470662 GCGTATGTGGGGCATTCCTTAGG + Intergenic
965114518 3:164470662-164470684 GCGTATGTGGGGCATTCCTTAGG + Intergenic
965878009 3:173351837-173351859 GTGTGTTTGGGTCATTTGACAGG - Intergenic
967892802 3:194375066-194375088 GCCTGTGTGGGGCAGTTCCAAGG - Intergenic
974293133 4:59960361-59960383 GGGTGTTTGGATCATTTCACGGG - Intergenic
982350254 4:154407661-154407683 GGTTGTGTGGGGCACCTCACTGG - Intronic
985036382 4:185844375-185844397 GGGTGTGTTTTGCATTTCACTGG - Intronic
985471809 5:51161-51183 GCCTGGGTGGGGCATCTCCCTGG + Intergenic
985634540 5:1029541-1029563 GCACTTGTGGGGGATTTCACTGG - Intronic
988119161 5:26937927-26937949 GTGTGTGTTGGGCAGTTCAATGG - Intronic
997663724 5:135610067-135610089 GGGTGTGTGTGGAATTTCCCAGG + Intergenic
997768237 5:136526517-136526539 GAGTGTGTGGGGCTTTTCATGGG + Intergenic
1001893691 5:175360919-175360941 GAGGGTGTGGGGCTGTTCACCGG - Intergenic
1008881786 6:56387631-56387653 GAGTGTGTGGGACTTTGCACTGG + Intronic
1017412941 6:154188510-154188532 GTATGTGTGGGTAATTTCACTGG + Intronic
1017748913 6:157471742-157471764 GCCTCTGAGGGGCATTTCAAAGG - Intronic
1019396528 7:822913-822935 GTGTGTGTGTGGGAATTCACGGG - Intronic
1019396537 7:822949-822971 GTGTGTGTGTGGGAATTCACGGG - Intronic
1019995407 7:4721249-4721271 GCCTGTGTGTGGCAGTGCACAGG + Intronic
1023898539 7:44455293-44455315 GCGTGTGTATGGCACTGCACGGG + Intronic
1024264098 7:47593565-47593587 GCTTGGCTGGGGCTTTTCACTGG - Intergenic
1026085647 7:67260873-67260895 AAGTGTGTGTGGCATGTCACTGG + Intergenic
1028290138 7:89055647-89055669 GCATGTGTGAGACTTTTCACTGG - Intronic
1039441629 8:37599034-37599056 GCGAGGGTGGGGAATTTCAGAGG - Intergenic
1046438109 8:114221349-114221371 GGATGTGTGGGACATTTCAATGG + Intergenic
1048166264 8:132064148-132064170 GCAAGTGTGGGGCAGTGCACTGG + Intronic
1049413771 8:142485722-142485744 GCGTGTGTGGGCCATTCCAGGGG - Intronic
1054879902 9:70134277-70134299 GGGTGTGGGGGGCAGTTCATTGG - Intronic
1056399521 9:86213041-86213063 GCTTGTGTGGGCCCTTTCCCTGG + Intergenic
1062303742 9:135890202-135890224 ATGTGTGTGGAGCATTCCACAGG - Intronic
1185482721 X:459725-459747 GCGTGTGTGGGGAAATTCTGGGG - Intergenic
1194884850 X:99301340-99301362 GAGGTTGTGGGGCTTTTCACAGG + Intergenic
1195045315 X:101050109-101050131 GAGTGTGTGGGTCCTCTCACTGG + Intronic
1200135954 X:153874794-153874816 CCGTGTGAGGGGCATGTCACAGG - Intronic