ID: 1078017811

View in Genome Browser
Species Human (GRCh38)
Location 11:7630254-7630276
Sequence GTGACCAGTCAGTCACATCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 103
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 92}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078017811 Original CRISPR GTGACCAGTCAGTCACATCC TGG (reversed) Intronic
907570224 1:55476479-55476501 CTGACCGGTCAGTGACACCCAGG - Intergenic
910081232 1:83344243-83344265 GGGACCATTCTGTGACATCCTGG + Intergenic
911552929 1:99306282-99306304 GTGTCCATTCAGTCCCGTCCTGG + Exonic
915576790 1:156784509-156784531 GTGACAAGTCAGACACTTCAAGG + Intronic
915950373 1:160186384-160186406 GTGACCACTCAGTCAGAGCGGGG - Intronic
916025943 1:160833580-160833602 CTGGCCAGTCAGTCACCTGCTGG - Intronic
920686041 1:208109708-208109730 GCGAACAGTCAGTCCCATCATGG - Intronic
923639477 1:235739403-235739425 TTTCCCAATCAGTCACATCCTGG + Intronic
1062974540 10:1673828-1673850 GTGCCCACTCAGCCACTTCCGGG + Intronic
1065846434 10:29747473-29747495 TTGACCAGTCAGCCCCACCCTGG + Intergenic
1065961985 10:30741136-30741158 GTGACCAGGAAGTCACTCCCAGG + Intergenic
1066495118 10:35934989-35935011 GTGACAGGTCAGTCAAACCCTGG + Intergenic
1066647229 10:37622279-37622301 GTGACGGGTCAGTCAAACCCTGG - Intergenic
1068867482 10:61909730-61909752 GTGACCAGTCATTCACATGTGGG + Intronic
1072677567 10:97479628-97479650 TTTCCCAATCAGTCACATCCTGG + Intronic
1075018806 10:118932283-118932305 TTTTCCAATCAGTCACATCCTGG - Intergenic
1078017811 11:7630254-7630276 GTGACCAGTCAGTCACATCCTGG - Intronic
1078598966 11:12714186-12714208 GTTCCCAAGCAGTCACATCCAGG + Intronic
1079205066 11:18407646-18407668 TTTCCCAGTGAGTCACATCCTGG + Exonic
1083881082 11:65548578-65548600 GTGCACAGGCAGTCAGATCCAGG + Intronic
1090494406 11:127195869-127195891 GTGATCAGACAGTTCCATCCTGG + Intergenic
1090794430 11:130122686-130122708 GTGGGCAGGCAGGCACATCCAGG + Intronic
1093625550 12:21342983-21343005 ATGACCTGTGCGTCACATCCAGG + Intronic
1096817986 12:54213719-54213741 GTGCCCAGCTAATCACATCCTGG - Intergenic
1096913789 12:55010483-55010505 GTGACAATTTAGTCACATCCAGG - Intergenic
1098280268 12:68855331-68855353 GGTACCTGTGAGTCACATCCAGG + Exonic
1098674768 12:73275191-73275213 GTATCCAGTGAGTCACATTCTGG + Intergenic
1098868071 12:75784756-75784778 GTTACCAGCCAGTGCCATCCAGG + Intergenic
1104220172 12:126775119-126775141 GTGAGCAGGCAGTCACATCTGGG - Intergenic
1104850736 12:131872331-131872353 GTGACCTGTCTGTCCCATCATGG + Intergenic
1109159560 13:58955761-58955783 GTTACTAGACATTCACATCCCGG + Intergenic
1111044503 13:82796900-82796922 GTGACCAGTCAGTTACCTGGTGG + Intergenic
1111858719 13:93673573-93673595 GTGATCATTAAGTCACTTCCTGG - Intronic
1113268925 13:108651138-108651160 GAGACCAGCCAGCTACATCCAGG - Intronic
1118896760 14:69951885-69951907 GTGCCAAGTAATTCACATCCAGG - Intronic
1119536841 14:75409618-75409640 CTGCCCAGTCAGTCACTCCCTGG - Intergenic
1119847853 14:77844036-77844058 ATGATCAGTCATTCACATCCTGG - Intronic
1121335080 14:93072973-93072995 GTGGCCAGTCATTGTCATCCTGG - Intronic
1121397915 14:93643283-93643305 GAGAGCAGTCACTCACATGCAGG + Intronic
1122479995 14:102040949-102040971 GTGACCATTCATTCACAGACAGG - Intronic
1133160340 16:3907722-3907744 GTCACCTGTCAGTCACCTGCAGG - Intergenic
1135387050 16:22051760-22051782 GACACCAGTCAGTCACAAGCCGG - Intronic
1143207195 17:5152003-5152025 GTGACCCGTCCGTCTCATCTCGG - Intronic
1145986359 17:29049570-29049592 GAAACCAGTCAGTCAAAACCGGG - Intronic
1149446214 17:56715209-56715231 GTGCCCAGCCATTGACATCCTGG - Intergenic
1152008155 17:77695239-77695261 GTGGCCAGGCAGCCACCTCCTGG - Intergenic
1154014661 18:10605519-10605541 CTGAACACTGAGTCACATCCAGG + Intergenic
1154190826 18:12230056-12230078 CTGAACACTGAGTCACATCCAGG - Intergenic
1160454470 18:78990790-78990812 GTTACGAGTCAGTAATATCCAGG + Intronic
1166912762 19:46172140-46172162 ATAACCATTCAGTTACATCCAGG - Intergenic
929423722 2:41821442-41821464 TTTCCCAGTCAGTCACATCCTGG + Intergenic
929789278 2:45011686-45011708 GAGACCAGGCAGTCACTTCCTGG + Intergenic
930862003 2:56084265-56084287 GAGACCATCCAGTCACATGCAGG + Intergenic
931994491 2:67826951-67826973 GTGGCCAGTCACTCACTTACAGG + Intergenic
932008130 2:67948051-67948073 GTGACCATATAGTCACATGCAGG - Intergenic
933642220 2:84776171-84776193 TTTCCCAATCAGTCACATCCTGG - Intronic
935924069 2:108048228-108048250 GGGACCAGTCAGCCACATGGTGG - Intergenic
936774384 2:115955243-115955265 GTGATTAGTCAGTCACATAGTGG + Intergenic
942658321 2:178237992-178238014 GTGACCTGGCAGCCAAATCCAGG + Intronic
947856305 2:233326839-233326861 GTGGAGAGTCATTCACATCCTGG - Intronic
948146383 2:235711182-235711204 GTGGCCAGTCAGTGCCATCAAGG + Intronic
948393923 2:237631050-237631072 GTGACCTGTCAGACTCATCCTGG + Intronic
948935003 2:241158130-241158152 GTGGCCAGTCATACACAGCCTGG - Intronic
1169545974 20:6651251-6651273 ATGACCCGTGAGTCACACCCAGG + Intergenic
1175116439 20:56685919-56685941 GGGTCCAGGCAGGCACATCCTGG - Intergenic
1175799860 20:61795448-61795470 GTGAGCAGGAAGTCACATCATGG + Intronic
1183712585 22:39514110-39514132 GAGACCAGTCAGCCTCCTCCTGG - Exonic
1184715524 22:46279781-46279803 GTGACCAGACAGCACCATCCAGG + Intronic
950449649 3:13058556-13058578 GTGGCCAGTCAGCACCATCCAGG + Intronic
960662103 3:120071630-120071652 GTGACTAGACAGTCCCATCTGGG - Intronic
961584169 3:127908539-127908561 GGGGGCAGTCAGTGACATCCTGG + Intergenic
961803303 3:129469360-129469382 GTCCCCAGTCAGCCACAGCCAGG - Exonic
962700240 3:137991262-137991284 GTGAAAAGTCATTCACATCAGGG - Intergenic
962703467 3:138021316-138021338 GAGACCAGTTAATAACATCCAGG - Intronic
963902642 3:150746958-150746980 CTGACCAGTCAGCCACACTCTGG - Intronic
969304852 4:6319755-6319777 GTGGCCAGTGACGCACATCCAGG + Intergenic
974584786 4:63858576-63858598 GTCTCCAGTCATTTACATCCTGG - Intergenic
981578600 4:146230077-146230099 GTGACCAGTCAGAGGCATCCAGG + Intergenic
981614520 4:146633313-146633335 GTGACCAGGAACTCACATTCAGG - Intergenic
982081487 4:151794354-151794376 CTCTCCACTCAGTCACATCCAGG + Intergenic
987093635 5:14529160-14529182 GTGTCCAATCAGTGACAGCCTGG - Intronic
987184914 5:15407479-15407501 GCAACCAGACAGTCCCATCCGGG + Intergenic
990731325 5:58812151-58812173 CTGAACACACAGTCACATCCAGG - Intronic
1001712059 5:173786891-173786913 GTGAGGAGTCTGTCACATTCTGG - Intergenic
1007788375 6:44295058-44295080 GTGACCCTTCAGCCACCTCCAGG - Intronic
1008321643 6:50121471-50121493 GTGCCCGGCCAGTCACATACTGG - Intergenic
1010600676 6:77822207-77822229 TTGTCCAGTCAGTGACATACTGG + Intronic
1018185079 6:161259896-161259918 TTCACCATTGAGTCACATCCTGG + Intronic
1019340503 7:506790-506812 GCTGCCGGTCAGTCACATCCTGG + Intronic
1020028218 7:4914601-4914623 GTGCCCAGTCAATCACAACCAGG + Intronic
1027298713 7:76806497-76806519 GGGACCATTCTGTGACATCCTGG + Intergenic
1028851538 7:95543462-95543484 GTGACAAGTCCGTGACAGCCTGG + Intergenic
1035837041 8:2765443-2765465 GTGTCCACACAGTCACAGCCTGG + Intergenic
1048506191 8:135024254-135024276 GTGACCACTCAGCCTCCTCCTGG - Intergenic
1050561688 9:6840724-6840746 GTGCCCAGTCAGTAACTTACAGG - Intronic
1051227799 9:14920950-14920972 TTTCCCAGTCAGTCACATCCTGG - Intergenic
1054763985 9:69027330-69027352 GTGGCCAGGCACACACATCCAGG - Intergenic
1062546881 9:137067839-137067861 CTGACAAGTCAGGCACGTCCTGG + Intronic
1185708751 X:2285280-2285302 GTGACTAGACAGTCCCATCTGGG + Intronic
1186977421 X:14923080-14923102 GAGACCACCCTGTCACATCCCGG - Intergenic
1190911291 X:54774772-54774794 GTCAGCAGCCAATCACATCCAGG - Intronic
1190919926 X:54841438-54841460 GTCAGCAGCCAATCACATCCAGG + Intergenic
1197114638 X:122818078-122818100 GTGGCCACTCAGGCACACCCAGG + Intergenic