ID: 1078019067

View in Genome Browser
Species Human (GRCh38)
Location 11:7640375-7640397
Sequence GGGCAAGGGTGTCGGTCTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 127
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 118}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078019059_1078019067 5 Left 1078019059 11:7640347-7640369 CCTTAGGCAAATGAAGTCAGTGG 0: 1
1: 0
2: 0
3: 13
4: 173
Right 1078019067 11:7640375-7640397 GGGCAAGGGTGTCGGTCTGCAGG 0: 1
1: 0
2: 0
3: 8
4: 118
1078019057_1078019067 21 Left 1078019057 11:7640331-7640353 CCAAGTGGGAGCATTTCCTTAGG 0: 1
1: 0
2: 0
3: 9
4: 150
Right 1078019067 11:7640375-7640397 GGGCAAGGGTGTCGGTCTGCAGG 0: 1
1: 0
2: 0
3: 8
4: 118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078019067 Original CRISPR GGGCAAGGGTGTCGGTCTGC AGG Intronic
900078664 1:838090-838112 CAGCAAGGGTGTCGCTCTGGTGG + Intergenic
900415511 1:2532734-2532756 GGGCCAGGATGGCGGCCTGCCGG + Intergenic
900576242 1:3383872-3383894 GGGCAGGTGTGTCCTTCTGCAGG - Intronic
900576249 1:3383906-3383928 GGGCAGGTGTGTCCTTCTGCAGG - Intronic
901151022 1:7101307-7101329 GGGAAAGGGAGTTGGCCTGCGGG + Intronic
901242940 1:7705221-7705243 GAGCAAGGGTGAGGGGCTGCAGG + Intronic
902527699 1:17070058-17070080 GGGCGAGGGTTGGGGTCTGCAGG + Intronic
904374044 1:30068614-30068636 GGGGAGGGGTCTGGGTCTGCAGG + Intergenic
907053437 1:51344867-51344889 GGGAAAGGGTGTGTGGCTGCTGG - Intronic
907286750 1:53385386-53385408 GGGCAGGGGTGTGGGCCTGAGGG + Intergenic
909487417 1:76189196-76189218 AGGCAAGGGTGCCTATCTGCTGG + Intronic
910453515 1:87371676-87371698 GGGCCTGGGTGGCGGTGTGCTGG + Intergenic
915031928 1:152886997-152887019 AGGCAAGGCTATGGGTCTGCAGG + Intergenic
915336807 1:155148489-155148511 GGGCACGCGGGTCGGTCTGGGGG - Intergenic
915489463 1:156243156-156243178 GGTCTAGGGTGTCGCTCTGCTGG + Exonic
915676895 1:157540320-157540342 AGGTAAGGGTGTGGTTCTGCTGG - Intronic
916233414 1:162561942-162561964 GGGCTGGGGTGTGTGTCTGCGGG - Intronic
916631362 1:166617933-166617955 GGGGAAGGGTGGCTCTCTGCTGG + Intergenic
921188623 1:212690892-212690914 GGGCAATTGTGGCAGTCTGCAGG + Intronic
923052625 1:230399440-230399462 CGGCAAGGGGTTAGGTCTGCAGG - Intronic
923463845 1:234231364-234231386 GTGCAGGGGTGAAGGTCTGCAGG + Intronic
924308780 1:242719115-242719137 TGGAAAGGATGTCTGTCTGCCGG + Intergenic
1067089774 10:43260611-43260633 GGGCACGGGAGTCTGCCTGCTGG - Intronic
1069877809 10:71573925-71573947 GTGCAAGGGAATCGGCCTGCAGG - Intronic
1074404085 10:113165723-113165745 GGGCCAGGGGGTCGGGCTTCAGG - Exonic
1074813263 10:117126059-117126081 GGTCAAGGGCGTGGGTCTGGAGG + Intronic
1074987041 10:118668006-118668028 GTGCAAGGTTGTGGGTTTGCAGG + Intergenic
1075686940 10:124370989-124371011 TGGCAGGGGTGTCAGTATGCGGG - Intergenic
1077487711 11:2846647-2846669 GTGCCAGGGTGCCGGCCTGCCGG + Intronic
1078019067 11:7640375-7640397 GGGCAAGGGTGTCGGTCTGCAGG + Intronic
1084477216 11:69395834-69395856 GGGGAAGGGTGGTGGACTGCAGG - Intergenic
1084579956 11:70017027-70017049 GGGCAAGGATTCCTGTCTGCAGG + Intergenic
1092914515 12:13177944-13177966 GGGAAAGGGTGTCAGTGTCCTGG + Intergenic
1093079123 12:14789034-14789056 GGGCCAGGGGGTCGGCCTGGTGG + Exonic
1093685198 12:22046607-22046629 GGGAGAGGGAGTCGGGCTGCTGG + Intronic
1096649579 12:53055454-53055476 GGGCAAGGCTGGGGGTCTGCTGG - Intronic
1097152388 12:56988456-56988478 GGGGAAGGGTGGCGGCATGCGGG + Intergenic
1098659321 12:73072736-73072758 GGGCAAGGCTGTAGGTGAGCTGG + Intergenic
1103212456 12:119176670-119176692 GGGCAGGGGTCTCTGTCTGTCGG + Intergenic
1104669486 12:130670592-130670614 GGGAATGGGTGTCGGACTGGCGG - Intronic
1105000857 12:132688488-132688510 GGCCAAGGGAGCGGGTCTGCGGG + Intronic
1105000869 12:132688527-132688549 GGCCAAGGGAGCGGGTCTGCGGG + Intronic
1105001040 12:132689073-132689095 GGCCAAGGGAGCGGGTCTGCGGG + Intronic
1105001052 12:132689112-132689134 GGCCAAGGGAGCGGGTCTGCGGG + Intronic
1117546037 14:56795288-56795310 GGGCGAAGGTCTCGATCTGCCGG + Intergenic
1118270516 14:64338649-64338671 GGGGAGGGGGGGCGGTCTGCGGG - Intergenic
1120225547 14:81787285-81787307 GGGCAAGGCTGTTGGCCTCCTGG + Intergenic
1120953325 14:90061601-90061623 GGACACGGGTGTCAGTCTGCTGG - Intergenic
1123634774 15:22293213-22293235 TGTCAAGGGTGTGGCTCTGCAGG + Intergenic
1129570817 15:76682157-76682179 GGGGAAGGTTGTCGGTAGGCTGG - Intronic
1129790505 15:78337900-78337922 GGACAGTGGTGTCGTTCTGCAGG - Intergenic
1130520645 15:84658359-84658381 GGGCCAGAGTGTGGGTGTGCAGG - Exonic
1131844450 15:96473639-96473661 GGGCAAGGTTCTCATTCTGCGGG + Intergenic
1136570392 16:31093396-31093418 GGGCAGGGGTTTCGGGCTGGTGG - Exonic
1137446831 16:48537034-48537056 GGTCAAGGCTGTCAGTCTTCAGG - Intergenic
1138588732 16:57987789-57987811 GGGCTTGGGTGTGGGGCTGCAGG - Intronic
1139956140 16:70693904-70693926 GGGCCAGGGTGTTGGTGCGCAGG + Intronic
1141936003 16:87238193-87238215 TGGCATGGGTGTGGCTCTGCTGG - Intronic
1143709602 17:8725285-8725307 GGACAAGGCTTTCGGTCAGCTGG - Intergenic
1145964741 17:28908716-28908738 GGGTAAGGGTGTCAGTCTTTAGG + Intronic
1147955815 17:44133870-44133892 GAGCAAAGCTGTCAGTCTGCTGG + Intergenic
1148667926 17:49388519-49388541 GGGCAGGGGTGCCAGTGTGCTGG + Intronic
1151703168 17:75753945-75753967 GGGCCCGGGTGTCGCACTGCGGG - Exonic
1152162250 17:78676062-78676084 AGCCAAGGGCGTTGGTCTGCGGG - Exonic
1153262483 18:3237976-3237998 GGGCAGGGGTGGCGGTCGGGGGG + Intergenic
1157599287 18:48884332-48884354 GGGAAGGGGTGAAGGTCTGCAGG + Intergenic
1160810654 19:1011586-1011608 GGGCCAGGATGACGGTCAGCAGG + Exonic
1161662222 19:5553945-5553967 GGGCAAGGCTGTGGCTCTGCTGG - Intergenic
1162023603 19:7880197-7880219 GGGGAAGAGTGTGTGTCTGCGGG - Intergenic
1163565544 19:18049034-18049056 GGCCAATGGTCTCGGTGTGCTGG - Intergenic
1167638188 19:50667168-50667190 GGGCAGGTGTGTCGGGCAGCGGG + Exonic
1168676190 19:58279445-58279467 GGGCAAGGGTGTCGGCGGGGCGG - Exonic
926217282 2:10913353-10913375 GGGCATAGGTGAGGGTCTGCAGG - Exonic
933181717 2:79235062-79235084 GGGCTAGAGTGTCTGTTTGCAGG + Intronic
933812330 2:86040489-86040511 GGGCGAGGCTGTGGGCCTGCTGG - Exonic
934856987 2:97735589-97735611 GGGTATGGGTGTGGGTGTGCAGG - Intronic
934857626 2:97738996-97739018 GGGCCAGGGTATCAGTGTGCTGG - Intronic
946445066 2:219731532-219731554 CGGCAAGGGAGAGGGTCTGCAGG + Intergenic
946883166 2:224196209-224196231 GGTCAAGGGTGTCTTTCTGCAGG + Intergenic
1168789803 20:568438-568460 GGGGAAGGGGGTGGGGCTGCTGG - Intergenic
1172986059 20:38990964-38990986 GGGCTATGGTGTCAGACTGCTGG - Intronic
1174485021 20:50855587-50855609 GGGGAAGGGTGTGGGCCGGCAGG + Intronic
1174494512 20:50930575-50930597 GGAGAAGGGGGTCGGGCTGCAGG + Intronic
1174575593 20:51534766-51534788 GGGCGAGGGTGTCTGGCTTCAGG - Intronic
1175922424 20:62456359-62456381 GGGCAAGGCTGCCCCTCTGCAGG - Intergenic
1178349693 21:31863873-31863895 GGACCAGGGTGCCGTTCTGCAGG - Intergenic
1179129175 21:38619139-38619161 GGGGAAGGAAGTCGGTCTACAGG - Intronic
1181029291 22:20142211-20142233 GGCCAAGGGTCTGAGTCTGCAGG + Intronic
1181736702 22:24887252-24887274 GGGCCAGGGTGTGGGTATGGGGG - Intronic
1181776809 22:25165964-25165986 GGGAAAGGGTTACGGCCTGCGGG - Intronic
949752980 3:7375716-7375738 GGGCAAGGGTGTAGTTTTGCAGG - Intronic
950364435 3:12473080-12473102 GGAGAAGGGTGTGGGGCTGCGGG + Intergenic
951728206 3:25783232-25783254 GGGCAACGGGGTCGGACGGCGGG - Intronic
955365558 3:58307018-58307040 GGGCAAGGGTGTGAGTCCGGTGG + Intronic
971258966 4:25038994-25039016 GGGCAAGGGGGTGTGTCTGTTGG + Intergenic
971799255 4:31267138-31267160 GGGCCATTGTGTAGGTCTGCAGG - Intergenic
975320122 4:73000548-73000570 GGGCTAGGGTGTGGGTTTGTGGG - Intergenic
978129556 4:105178644-105178666 GGGGAAGGTTGTGGGTCTGTGGG + Intronic
992365182 5:76083486-76083508 GGGCAAGGGTGTCCGACGGCTGG + Exonic
1002079109 5:176727257-176727279 GGACAAGAGTGTGGGTCTCCAGG + Intergenic
1002296168 5:178232511-178232533 GGGCCAGCGTGTCGGCCTTCGGG + Exonic
1006327723 6:33366319-33366341 GGGGAAGAGTGTGTGTCTGCGGG - Intergenic
1007266553 6:40600619-40600641 GGGTGAGGGTGTCGCTCTTCTGG + Intergenic
1016683489 6:146856425-146856447 GGCCAAGGGTGCAGGCCTGCTGG - Intergenic
1019423730 7:963495-963517 GGGCAGTGGGGTTGGTCTGCGGG - Intronic
1019791072 7:3014308-3014330 GGGCAAAGGGGTCCTTCTGCAGG - Intronic
1027188581 7:75985530-75985552 GGGCAAGGGCCTCGGTGTGGCGG + Intronic
1034673255 7:152872763-152872785 GGGCAGGGGGGGCGGTCTGGTGG + Intergenic
1036650025 8:10636315-10636337 GGGAAAAGGAGCCGGTCTGCAGG + Intronic
1036787501 8:11697800-11697822 GGGCAAGGGTGCCGGGCCGGTGG + Intronic
1038625875 8:29192919-29192941 GGGTAAGGGTGGGGGCCTGCAGG + Intronic
1039470432 8:37809983-37810005 GGGCACTGGTGTCAGTGTGCAGG - Intronic
1040080396 8:43278193-43278215 GGGCAAGGGTGACAGTCTAGGGG - Intergenic
1044204328 8:89474599-89474621 GGCCCAGGGTGTCTGTCTGCTGG + Intergenic
1049812919 8:144583633-144583655 CAGCAAGGGTGACGGTGTGCTGG - Intronic
1051210482 9:14737111-14737133 GGGTAAGGGTGAGGGTCTTCTGG + Exonic
1053166059 9:35844762-35844784 GGGAAAGGGTGAGGGGCTGCAGG - Intronic
1060731074 9:126037373-126037395 TTTCAAGGGAGTCGGTCTGCAGG + Intergenic
1060952542 9:127612921-127612943 GGGGGAGGGTGACGGGCTGCAGG - Intronic
1061003874 9:127917315-127917337 GGGCGAGGCTGTCGGGCCGCAGG + Intergenic
1061534640 9:131239906-131239928 GGGCACTGGGGTCCGTCTGCTGG - Intergenic
1061541155 9:131278337-131278359 GGGCAAGGGAGCCCTTCTGCGGG - Intergenic
1061670358 9:132185040-132185062 AGGGAAGGGTGTCTGGCTGCAGG + Intronic
1192504148 X:71670688-71670710 GGACAGCGGTGTCGTTCTGCAGG + Intergenic
1197890456 X:131264901-131264923 GAGCAAGCATATCGGTCTGCGGG - Intergenic
1197941608 X:131795850-131795872 GGGCCAGTGTGTAGGTCTCCTGG + Intergenic
1199847046 X:151699069-151699091 GGGGAAGGGTGCCTGCCTGCTGG + Intronic