ID: 1078020566

View in Genome Browser
Species Human (GRCh38)
Location 11:7653166-7653188
Sequence ATCCAGTTCAGGGGCATCAA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 3, 3: 11, 4: 129}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078020566_1078020574 -10 Left 1078020566 11:7653166-7653188 CCCTTGATGCCCCTGAACTGGAT 0: 1
1: 0
2: 3
3: 11
4: 129
Right 1078020574 11:7653179-7653201 TGAACTGGATGGGCTGGACCAGG 0: 1
1: 0
2: 1
3: 17
4: 194
1078020566_1078020575 -7 Left 1078020566 11:7653166-7653188 CCCTTGATGCCCCTGAACTGGAT 0: 1
1: 0
2: 3
3: 11
4: 129
Right 1078020575 11:7653182-7653204 ACTGGATGGGCTGGACCAGGTGG 0: 1
1: 0
2: 3
3: 26
4: 371
1078020566_1078020576 -6 Left 1078020566 11:7653166-7653188 CCCTTGATGCCCCTGAACTGGAT 0: 1
1: 0
2: 3
3: 11
4: 129
Right 1078020576 11:7653183-7653205 CTGGATGGGCTGGACCAGGTGGG 0: 1
1: 0
2: 2
3: 26
4: 274

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078020566 Original CRISPR ATCCAGTTCAGGGGCATCAA GGG (reversed) Exonic
903910975 1:26724855-26724877 ATGCAGTTTAGGGGCATCAAAGG - Intronic
909873979 1:80779602-80779624 ACCCAGTCCGGGGGCAGCAAGGG - Intergenic
909898050 1:81098708-81098730 ATCAGGATCAGGGGTATCAATGG - Intergenic
910267416 1:85352363-85352385 TTCCAGTTCAGGGTCATCAAGGG - Intronic
910611990 1:89154754-89154776 ATTAAGTTCAGGGGCACCACTGG - Intronic
910855231 1:91688277-91688299 ATCCTATTCAGGGGCCACAAAGG - Intronic
911680096 1:100705280-100705302 AGCCAGGTCAAAGGCATCAAAGG - Intergenic
915484328 1:156209697-156209719 TTCCAGCTCTGGGGCTTCAAGGG + Intronic
917026292 1:170646262-170646284 TTCCAGTTCAGGGTCATGGATGG + Intergenic
918650465 1:186956309-186956331 ATCCAGTTCATCATCATCAAAGG - Exonic
919331316 1:196175745-196175767 TTCCAGTTCAGGGTCATGGATGG - Intergenic
921519353 1:216140708-216140730 GTCCAGCTCAGGGGCCTGAAGGG + Intronic
924156504 1:241182151-241182173 ATCCAGTTCAGGGACGTGAATGG - Intronic
1062952078 10:1511600-1511622 ATCCAGTGTAGTGGCATTAATGG - Intronic
1067552103 10:47243495-47243517 ATCCAGATCATGGGCTTGAAAGG - Intergenic
1069035624 10:63643187-63643209 ATCCAGTGCAGGGCTATGAAGGG - Intergenic
1071363151 10:84871017-84871039 TTCCAATTCAGGAGCATGAAAGG - Intergenic
1074394670 10:113087770-113087792 CTCCAGTTATGGGGCAGCAATGG + Intronic
1074715765 10:116217184-116217206 ATCCAGTGCTGTGGCACCAAAGG + Intronic
1075961383 10:126570177-126570199 ATACTGTGCAGGGGAATCAAAGG - Intronic
1077309311 11:1881446-1881468 ATCCAGTTCAGGGGCCTCCGAGG - Exonic
1078020566 11:7653166-7653188 ATCCAGTTCAGGGGCATCAAGGG - Exonic
1078320231 11:10327929-10327951 TTCCAGTCCAAGGGCATTAATGG + Intronic
1079087538 11:17457553-17457575 AGCCAGATCAGTGGCATCCATGG + Intronic
1085338154 11:75713179-75713201 AGCCAGTCCATGGGCATCACTGG - Intergenic
1086902451 11:92383139-92383161 GTCCTGTGCAGGGACATCAATGG - Intronic
1087332648 11:96800310-96800332 ATCCTTTTCAGGGACATGAATGG - Intergenic
1087956779 11:104298249-104298271 TTCCAGGGCAGGGGCTTCAATGG + Intergenic
1091656529 12:2350597-2350619 CTTCAGTTCATGGGCATCAATGG - Intronic
1092203449 12:6601409-6601431 AGGCAGTTCTGGGGCATCAGTGG - Exonic
1093477695 12:19573796-19573818 CTCCAGTCCAAGGGCAGCAAGGG + Intronic
1097699347 12:62804019-62804041 AACCAGATAAGGGGCATCTAGGG + Intronic
1099988110 12:89692495-89692517 TTCCAGTTCAGGGTCATGAGTGG - Intronic
1100500854 12:95172728-95172750 ATGCAGTTCAGGAGCATCCCAGG - Exonic
1103897208 12:124280457-124280479 ATCCACTAGAGGGGCATCGATGG - Intronic
1103969143 12:124658922-124658944 ATTCAGTTCAGTGGCATGAAGGG + Intergenic
1104165589 12:126225978-126226000 GTCCTTTTCAGGGACATCAATGG - Intergenic
1105522967 13:21147950-21147972 AACCAGTTCAGAGGAAACAAGGG + Exonic
1106102510 13:26707167-26707189 TTCCAGTTCAGGGTCATGGATGG - Intergenic
1106418171 13:29563486-29563508 ATCTGGTTCAGGGACATCGAGGG - Intronic
1110911030 13:80963730-80963752 TTCCAGTTCTGGGGAAACAAGGG - Intergenic
1113141507 13:107156809-107156831 ATCCAGCTCAGTGTCAACAATGG - Intergenic
1118596896 14:67442660-67442682 ATACTGTTCAGGGACAGCAAAGG + Intergenic
1118977728 14:70692004-70692026 GACCAGTTCGGGAGCATCAAAGG + Intergenic
1119424177 14:74525034-74525056 CTCCAGGGCAGGGGCATGAATGG - Intronic
1120451477 14:84672932-84672954 ATTCAGGTCAGGGGCATGAGAGG - Intergenic
1121638369 14:95468871-95468893 TTGCAGTTCAGGGGCAGCTAAGG + Intronic
1125248869 15:37676535-37676557 TTTCAGTTCAGGGTCCTCAAGGG + Intergenic
1126879238 15:53076773-53076795 AACCTGTTCAGAGGCATGAAAGG - Intergenic
1128365666 15:67000343-67000365 TTCCATTTCAGTGGCATCACTGG + Intergenic
1129624112 15:77179008-77179030 CTCCAGTTCAGCGCCATCACTGG - Exonic
1132751743 16:1460818-1460840 CTCAAGTACAGGGTCATCAAGGG - Exonic
1133341042 16:5036256-5036278 ATACAATTCAGGGACCTCAAAGG + Intronic
1138489121 16:57366001-57366023 ATCCAGCTCAGTGTCATCCAGGG + Exonic
1140300187 16:73749834-73749856 GTACAGTTCAGGGCCATCCAAGG - Intergenic
1140552890 16:75886672-75886694 ATGCAGTGAAGAGGCATCAAAGG - Intergenic
1141943679 16:87295750-87295772 ATCCAGTTCATGATCACCAAGGG + Intronic
1143674446 17:8421702-8421724 AACCACTTCATGGGCATCTAAGG - Intronic
1145068663 17:19783715-19783737 CGGCAGTTCAGGGGCTTCAAAGG + Exonic
1146212977 17:30956445-30956467 AGCCGGTTGAGGGGCGTCAAGGG - Exonic
1146577927 17:34011412-34011434 ATCCAGTTCACAGGCAACACTGG + Intronic
1147449296 17:40493884-40493906 ATCCAGTCCTGGGGCATGAACGG + Intronic
1148534312 17:48425846-48425868 AAGCAGTTCAGGGGCAACTATGG + Intronic
1149538208 17:57448749-57448771 AACCAGGTGAGGGGCAGCAAGGG + Intronic
1151027829 17:70699842-70699864 ATCCAGTATCAGGGCATCAAGGG - Intergenic
1152398262 17:80048506-80048528 ATTCTATTCTGGGGCATCAATGG - Intronic
1152651307 17:81494716-81494738 ATCCACTGCAGGGGCTTCTAGGG - Intergenic
1164917669 19:32065110-32065132 ATCCTTTTCAGGGGCATGGATGG - Intergenic
1165015283 19:32875988-32876010 ATACAGTTCAGTGGCGTTAAGGG + Intergenic
1167087996 19:47323819-47323841 ATCCAGGTCAGGGGCAGCCATGG - Intergenic
1168496596 19:56856713-56856735 GACCAGTTAAGGGGCAGCAAAGG + Intergenic
927076948 2:19588328-19588350 ATCCAATTCAGGGGCCCCAGAGG - Intergenic
927829491 2:26336881-26336903 AGCCATTTCAGTGGCATCTATGG + Intronic
928454674 2:31408670-31408692 ATCCAGTTAAGAATCATCAATGG + Intronic
929873847 2:45779980-45780002 ATCCAGTTCAGGAGAACCTATGG - Intronic
931660575 2:64558773-64558795 TTCCAGCTCAGGGTCATCAGTGG + Intronic
938685105 2:133730489-133730511 ATCCAGTGTAGGGGCTTCAAGGG - Intergenic
939398832 2:141665766-141665788 ATCCTTTTCAGGGACATAAATGG + Intronic
940558841 2:155267468-155267490 ATCCAGGTCAGGAAAATCAAAGG + Intergenic
940857058 2:158737671-158737693 AGCTAGTTCAGGGGCACTAAGGG - Intergenic
941451927 2:165670354-165670376 CTCCAGTTCATTGGGATCAAGGG + Intronic
942090699 2:172487765-172487787 ATCCAGATCTGGGGTGTCAAAGG - Exonic
947873512 2:233453079-233453101 ATCCAGTTCAGGGGCCTCTAGGG - Intronic
1173145111 20:40518059-40518081 ATACAGTTCAGTGGCATTAAGGG - Intergenic
1174513173 20:51071290-51071312 TTCCAGTTGAGATGCATCAAAGG - Intergenic
1175945679 20:62557712-62557734 ATCCTGCCCGGGGGCATCAAAGG - Intronic
1176307513 21:5131633-5131655 ATCCAGCCCTGGGGCAGCAAAGG + Intronic
1179849547 21:44130397-44130419 ATCCAGCCCTGGGGCAGCAAAGG - Intronic
1181255456 22:21559870-21559892 ATCCAGTGCTGGGGGATGAAAGG - Intronic
1183377870 22:37475609-37475631 ATCCAGGGCAGCGGCATTAATGG - Intronic
1183867544 22:40715780-40715802 TTGCAGTTGAGGGGCATTAAAGG + Intergenic
1183964308 22:41432076-41432098 AAACAGTTCTGGGGCATCAGTGG - Intergenic
950463343 3:13138640-13138662 CTCTAGTTCAGGGGCACCACAGG + Intergenic
957211691 3:77267348-77267370 ATCCAGTTCTTGGACATCACAGG + Intronic
960193399 3:114734769-114734791 TTCCAGTTCAGGGTCATGAGTGG + Intronic
960502023 3:118449295-118449317 ATCCATTCCAGGGGCATGGATGG - Intergenic
963895795 3:150683857-150683879 ATCTAGTTCAGGGGTAGCAGTGG - Intronic
969970292 4:11040014-11040036 AGCCTGTTCAGGGTAATCAAGGG - Intergenic
970277186 4:14413800-14413822 ATCCAGAGCAGGGGTATCTAGGG + Intergenic
970467632 4:16342960-16342982 GTCCTTTTCAGGGGCATGAATGG - Intergenic
970784286 4:19777320-19777342 ATCCAGTTCTGTCGCAGCAAGGG - Intergenic
971131669 4:23817951-23817973 AACTAGTTCAGAGGCAGCAAGGG - Intronic
981207590 4:142062182-142062204 AATCAGTTCAGGCGCACCAAGGG + Intronic
984467071 4:180113354-180113376 ATCAAGTTCAGCGGTTTCAATGG - Intergenic
989669050 5:43892466-43892488 TTCCAGTTCAGGGTCATGAGTGG + Intergenic
992674621 5:79093421-79093443 TTCCAGTTCAGTGAAATCAAGGG + Intronic
992869531 5:80992335-80992357 ATCCCACTCAGGGGCATCAGTGG + Intronic
994356971 5:98803608-98803630 ATCCAGTGCAGGGGAAGCAAAGG + Intergenic
997982030 5:138473893-138473915 ATCAGGATCAGAGGCATCAATGG + Intergenic
998609389 5:143671515-143671537 ACCCACTTCAGAGGCAGCAAAGG + Intergenic
999777072 5:154820112-154820134 ATCCCATTGAGGGACATCAAGGG + Exonic
1003895313 6:10601978-10602000 ATCCAGTTTTCCGGCATCAAGGG - Intronic
1007564429 6:42838563-42838585 ATTCAGGTGAGAGGCATCAAAGG - Intronic
1008074467 6:47131476-47131498 ATGCAGCTGAGGGGCAGCAATGG - Intergenic
1016895830 6:149051473-149051495 CACCAATTCAGGGGCATCATTGG + Intronic
1020719326 7:11721618-11721640 ATCCAGATGAGAGGCATCAGTGG - Intronic
1021886219 7:25142301-25142323 ATCCAGTTCAAGGGGGTCCATGG + Exonic
1022167832 7:27788438-27788460 ATGCAGGTGAGGAGCATCAAAGG - Intronic
1029265083 7:99332516-99332538 ATTCTGTTCAGGGTCGTCAATGG - Intronic
1031299593 7:120047565-120047587 AGCCAGATCAGGAGCAGCAATGG - Intergenic
1033116682 7:138631902-138631924 AGCCACTTCAGGGGGATAAATGG - Intronic
1033813106 7:145040643-145040665 ATCAAGATCAGAGGTATCAATGG - Intergenic
1034478409 7:151302084-151302106 AACCAGTACAGTGGCACCAAGGG - Intergenic
1036406188 8:8457190-8457212 GTACAGTTCAGTGACATCAAGGG + Intergenic
1043909472 8:85844457-85844479 ATCCAGTCAAGGGGCAGTAATGG - Intergenic
1044546685 8:93467417-93467439 ACGCAGTTCATGGCCATCAATGG + Intergenic
1044752745 8:95431652-95431674 ATCCAATTTAGGGGCTGCAAGGG + Intergenic
1044796474 8:95904141-95904163 ATCTAGGTAAGGAGCATCAATGG + Intergenic
1044960664 8:97528071-97528093 ACGCAGTTCATGGCCATCAATGG - Intergenic
1046885379 8:119361256-119361278 ATCCAGTTCTGTGGCAGCGAAGG - Intergenic
1047185154 8:122626448-122626470 ATCCAGTTCAGGGGAAAAGAGGG + Intergenic
1048273840 8:133050908-133050930 ATCCAGTCCTGGGGAAACAAAGG + Exonic
1048438270 8:134438102-134438124 TTCCATGTCAGGGGCATCACAGG + Intergenic
1050593518 9:7183642-7183664 ATCCCGATCAGGAGCAGCAATGG - Intergenic
1059605891 9:115835386-115835408 TTCCAGTTCAGGGTCACCAGGGG + Intergenic
1060236882 9:121870539-121870561 ATCCGGTTCCTGGGCATCAAGGG - Exonic
1060430682 9:123549012-123549034 ATACAGTTCATTGGCATGAATGG - Intronic
1189633075 X:42975595-42975617 ATCTAGTACAGGGGCACAAAAGG + Intergenic
1193128803 X:77898111-77898133 ATACAGTTCAGTGGCATTAATGG - Intergenic
1197345330 X:125321770-125321792 ATCATGTTCTGGGGCATCACTGG - Intergenic
1197345342 X:125321833-125321855 ATCATGTTCTGGGGCATCACTGG - Intergenic
1197602019 X:128542640-128542662 ATCCAGTTCTGTGCCATCGATGG + Intergenic
1200428136 Y:3045349-3045371 TTACAGTTCAGGGACATAAACGG - Intergenic
1201748541 Y:17406655-17406677 ATATAGTTCAGTGGCATTAAGGG - Intergenic