ID: 1078022292

View in Genome Browser
Species Human (GRCh38)
Location 11:7665933-7665955
Sequence CAGGGACCTGTATGACAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 185
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 168}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078022292 Original CRISPR CAGGGACCTGTATGACAAGC AGG Intronic
900369188 1:2323918-2323940 CAGGGACCTGAATGGGAAGGGGG - Intronic
902368340 1:15991251-15991273 CAGGGCCCTGTAGGGCAAGGAGG - Intergenic
902402651 1:16166585-16166607 AAGGGACCTGGATGAGGAGCTGG + Intergenic
902748022 1:18486285-18486307 CAGGGACCTGAATGGAAATCTGG + Intergenic
903365246 1:22801995-22802017 CAGGGCCCAGCATGACAAGCAGG - Intronic
903659056 1:24965822-24965844 AAGGGCCCTGAATGACATGCTGG - Intergenic
906200514 1:43957252-43957274 CAGCAACCTCTATGACAAGCTGG + Exonic
906708446 1:47911860-47911882 CAGGGACTTGTGTGACACGCAGG + Intronic
907205253 1:52764822-52764844 CTGAGACCTGAATGACAAGGAGG + Intronic
907883829 1:58575864-58575886 CAAGTATCTGTATGACAACCCGG - Exonic
909042540 1:70671124-70671146 AAGGCAGCTGTGTGACAAGCAGG + Intergenic
912972894 1:114300610-114300632 CAGGGAGCTGTGTGATAGGCTGG - Intergenic
918450250 1:184650612-184650634 CGGGGACCTGTATGGAAAGATGG - Intergenic
921381896 1:214532932-214532954 CTGGGCCCAATATGACAAGCTGG + Intronic
922249797 1:223838043-223838065 CTGAGACCTGAATGACAAGAAGG - Intronic
1067213656 10:44282164-44282186 AAGGGTCCTGGAAGACAAGCTGG + Intergenic
1069876995 10:71569064-71569086 TAGGGACCTGAATGACCACCAGG - Intronic
1070025965 10:72632285-72632307 CAGGGAATTTTATGAGAAGCAGG + Intergenic
1070591796 10:77806909-77806931 CAGGGCCCTGTACGACCGGCTGG - Exonic
1072213797 10:93271339-93271361 CAGTGACCTGTCTTGCAAGCAGG + Intergenic
1073100124 10:101002130-101002152 CAGGGACCTGTGCTTCAAGCTGG + Exonic
1073796230 10:106991309-106991331 CAGTGACATGTTTGACAAGCTGG + Intronic
1074259803 10:111840468-111840490 CAGTGACCTCTATTGCAAGCTGG - Intergenic
1074615765 10:115066569-115066591 CTGGGTCCTGTATGACAAGCTGG - Intergenic
1074719337 10:116250987-116251009 CTGGGACCTAAATGACAAGGGGG - Intronic
1075101661 10:119510413-119510435 CTGGGATCTGAATGGCAAGCGGG - Intronic
1076375195 10:129979058-129979080 CTGGGACATTTATGGCAAGCAGG - Intergenic
1076661056 10:132056438-132056460 CAGGGCCCTGTAGGAAAAGATGG - Intergenic
1076790892 10:132776202-132776224 CAGAGACATGCATGACACGCAGG + Intronic
1077032588 11:476198-476220 CAGGGCCCTGTCTGCCCAGCCGG + Intronic
1077457016 11:2687426-2687448 CAGGGATCTGTATGGACAGCTGG - Intronic
1078022292 11:7665933-7665955 CAGGGACCTGTATGACAAGCAGG + Intronic
1079579711 11:22048432-22048454 CAGGGGCCTATATGGCAGGCTGG - Intergenic
1080555618 11:33414373-33414395 AAGTGAACTGTATTACAAGCTGG - Intergenic
1083296162 11:61716816-61716838 CAGGGGCCTGAATCACCAGCAGG + Intronic
1083462414 11:62823090-62823112 CAGAGACTTGAATGACAAGAGGG - Intronic
1085047178 11:73360361-73360383 CCGGGACCTGTCGGAGAAGCAGG + Exonic
1085955078 11:81382467-81382489 CTGAGACCTGTATGACAAAAAGG - Intergenic
1086176158 11:83893517-83893539 CAGGGATCTGAATGAAAAGGAGG - Intronic
1091639099 12:2221035-2221057 CTGGGACCTGGAAGACAAGAAGG + Intronic
1093863538 12:24197519-24197541 CAGGGTGCTGTTTGTCAAGCAGG - Intergenic
1098607033 12:72403649-72403671 CAGGGACCTGGATTAGATGCTGG + Intronic
1100359519 12:93863217-93863239 GTGGCACCTGTAAGACAAGCAGG + Intronic
1104728755 12:131093774-131093796 GAGGGACCTGTGTGTCCAGCTGG - Intronic
1110305686 13:73984443-73984465 CAGGGAACTGTGGGAGAAGCTGG - Intronic
1112356213 13:98676614-98676636 CAGGGACATGTGTGTCAACCGGG + Intergenic
1113968725 13:114171719-114171741 CAGGGACGTTTAAGACAAGATGG + Intergenic
1114361526 14:21978851-21978873 CAGGGACTTGGCTGTCAAGCTGG - Intergenic
1115662659 14:35512313-35512335 CTGGGCCCAATATGACAAGCTGG - Intergenic
1117980098 14:61334299-61334321 CAGGGAGGTGGATAACAAGCAGG + Intronic
1119951814 14:78752918-78752940 CTGGCACCTGGATGACAATCAGG - Intronic
1120441873 14:84551634-84551656 CAGGGACCTGCAGTACAAGCTGG - Intergenic
1120830992 14:88997067-88997089 CTGAGACCTGAATGACAAGAAGG - Intergenic
1121433355 14:93902980-93903002 CTGAGACCTGAATGTCAAGCTGG - Intergenic
1121513715 14:94534911-94534933 CAGAGACTTGTGTGACAAGGAGG + Intergenic
1124905023 15:33860181-33860203 GAGGAACCTGTAAGACATGCAGG + Intronic
1126011515 15:44307169-44307191 CAGGGACTTGTCTCATAAGCTGG + Intronic
1128793340 15:70448805-70448827 CAGGGTCCTGAAGGACAGGCAGG - Intergenic
1131027155 15:89153105-89153127 CTGAGACCTGAATGACAAGGAGG - Intronic
1135677806 16:24432104-24432126 CAGACACCTGAATGTCAAGCTGG + Intergenic
1136047220 16:27624235-27624257 CAGGGACCTAGATGGCAAGGAGG - Intronic
1136221183 16:28830043-28830065 CAGTCACCTGGATGCCAAGCTGG - Exonic
1140142491 16:72271959-72271981 CAGGGACCTATTTGACAGGCAGG + Intergenic
1140181991 16:72729368-72729390 CTGGGCCCAATATGACAAGCTGG + Intergenic
1145960173 17:28882638-28882660 CCGGGACCAGTTTGCCAAGCTGG - Exonic
1146055402 17:29578320-29578342 CATGGACGTGTATGACGAGGTGG - Exonic
1151052397 17:70993108-70993130 CAGGGATTTGTATGACATCCAGG - Intergenic
1151956823 17:77384286-77384308 CAAAGGCCTGAATGACAAGCGGG - Intronic
1152780458 17:82225536-82225558 CAGGGAGCTGTAAGGCAGGCAGG + Intergenic
1152920548 17:83064408-83064430 ATATGACCTGTATGACAAGCGGG - Intergenic
1153433186 18:5040827-5040849 CAGTGTCCTTTAGGACAAGCAGG + Intergenic
1153894298 18:9544506-9544528 CAGGCAGCTGTATCACAAGAGGG + Intergenic
1155345113 18:24850055-24850077 CAAGAACCTGTAGGAAAAGCAGG - Intergenic
1155595546 18:27481840-27481862 CAGGCACCTGAATGAAAAGAAGG + Intergenic
1158403404 18:57140860-57140882 CTGAGACCTGAATGACAAACAGG + Intergenic
1158498628 18:57979814-57979836 CAGGGACCAGTAGGACGAGTGGG + Intergenic
1158963934 18:62607518-62607540 CAGGGTCATGCATTACAAGCCGG - Intergenic
1160044999 18:75378663-75378685 CAGGGACCTGTATTTCTAGCTGG + Intergenic
1160121057 18:76130809-76130831 CAGGGACCTGTGAGAGAGGCGGG + Intergenic
1160607642 18:80064480-80064502 CAGGGACCTACAAGACAAGAGGG + Intronic
1161224283 19:3136051-3136073 CTGGGTCCTGTGTGACCAGCAGG - Intergenic
1161318702 19:3631328-3631350 CTGGGACCTGGATGGCCAGCAGG - Exonic
1162451967 19:10760508-10760530 CTGGGACGTGGATGACATGCGGG - Intronic
1162962944 19:14138695-14138717 CAGAGACTTGAATGACAAGAAGG - Intergenic
1163973480 19:20824646-20824668 CAGGGCCCTATATGCTAAGCTGG + Intronic
1167070574 19:47219905-47219927 CAGAGACCTCAATGAGAAGCAGG - Intergenic
927648502 2:24896625-24896647 GAGGGAGCTGTAAGACAAACAGG - Intronic
928174605 2:29025097-29025119 CAGGGGCCTGTTGGACCAGCTGG + Intronic
929863146 2:45696396-45696418 CAGGGACCTGTAAAACAAGGTGG - Intronic
931457611 2:62424564-62424586 TGGGGACCTGTGTGACAAGATGG + Intergenic
932571834 2:72942327-72942349 CAGGGACCAAGATGTCAAGCTGG - Exonic
933752447 2:85611767-85611789 CAGGGACGACTATGACAAGAAGG - Exonic
934935627 2:98463297-98463319 CAGGGACCTTAATGACAGCCAGG + Intronic
936728332 2:115350583-115350605 CAGAGATCTGTATGAAAAGGAGG + Intronic
936866909 2:117085379-117085401 CAGGCACCTTTCTCACAAGCTGG + Intergenic
937466681 2:122139029-122139051 CAGGGACATGTGGGACAATCAGG + Intergenic
938491133 2:131761866-131761888 CTGGGACCTGGGTGACAACCTGG + Intronic
938496431 2:131800471-131800493 CTGGGACCTGGGTGACAACCTGG - Intronic
938852064 2:135271377-135271399 TTAGGACCTGTATGACAAGGTGG - Intronic
939461816 2:142506029-142506051 CAAGGACCAGTCTTACAAGCTGG - Intergenic
942413015 2:175731351-175731373 CAGGGACATGCAGGACATGCAGG + Intergenic
943207594 2:184920176-184920198 GATGGTCCTGTATGACATGCAGG - Intronic
944690159 2:202151499-202151521 GAGAGAGCTGGATGACAAGCTGG - Intronic
946027815 2:216682604-216682626 CTGGAACCTGTTTGACAAACAGG + Intronic
947957061 2:234201280-234201302 CAAGGATATGTATGACCAGCTGG + Intergenic
948385795 2:237579859-237579881 CAGGGAACTGCAGGACATGCGGG - Intronic
1168874491 20:1161441-1161463 CAAGGACCTGTATGCCAACACGG + Intronic
1170011292 20:11727135-11727157 CAGGAACATCTATGACAAGTTGG - Intergenic
1170493399 20:16900607-16900629 CAGAGAACTGGAAGACAAGCGGG + Intergenic
1171064526 20:22001298-22001320 TAGGGACCTGTATGCTCAGCTGG + Intergenic
1171811083 20:29744390-29744412 CTGGCACCTGAGTGACAAGCTGG + Intergenic
1172896349 20:38302964-38302986 CAGGGACCTGTCTGGAAAGCTGG + Intronic
1173965686 20:47110824-47110846 CAGCCACGTGTGTGACAAGCAGG + Intronic
1175951748 20:62587372-62587394 CAGGGATCTGTTTTACAAGAGGG - Intergenic
1175968455 20:62671778-62671800 CAGGGGCTTGTATAAGAAGCAGG - Exonic
1179085495 21:38213215-38213237 CTGGCACCTGCAAGACAAGCAGG + Intronic
1179562287 21:42223173-42223195 CAGAGACCTGTAAGAAACGCAGG - Intronic
1181689675 22:24551626-24551648 CTGGGACCTGAATGACTAGAAGG - Intronic
1182676099 22:32041139-32041161 CAGGGACCTGAAAGAAAAGGAGG - Intergenic
950156501 3:10725077-10725099 CAGGGATCTGTATGACATGCTGG - Intergenic
950429279 3:12941570-12941592 CTCGGACCTGCAGGACAAGCAGG - Exonic
950680851 3:14584162-14584184 TAGGGACTTCTGTGACAAGCTGG + Intergenic
952822752 3:37499044-37499066 CACTGACCTGTAGGTCAAGCAGG - Intronic
952999815 3:38922267-38922289 CAGGAACCTGGAGGCCAAGCTGG + Intronic
957893457 3:86389040-86389062 GGGGGACCATTATGACAAGCTGG - Intergenic
960973429 3:123155096-123155118 GAAGGACCTGAATGACAAGAAGG - Intronic
961592522 3:127991396-127991418 CTGGGACCTCCATGACCAGCAGG + Intergenic
964442506 3:156726806-156726828 GAGGGTCCTGTGTGACAATCAGG - Intergenic
969275122 4:6129549-6129571 CAGGGACCAGGATACCAAGCAGG + Intronic
970050769 4:11912549-11912571 CAGGGAACTGGAGTACAAGCAGG + Intergenic
975699131 4:77045328-77045350 CAGGAACATTTATGACAAACTGG + Intergenic
976437179 4:85031543-85031565 CAGGGACATGAAAGACAAGAGGG - Intergenic
977916218 4:102596966-102596988 TAGGGAGCTATATGAAAAGCAGG + Intronic
979446912 4:120824426-120824448 CAGTGACTTGAATCACAAGCAGG - Intronic
979753244 4:124305390-124305412 CAGGCACCTGAATAATAAGCAGG - Intergenic
991994147 5:72370678-72370700 CAGGCACCTGAATGACATGCAGG - Intergenic
995532107 5:113101894-113101916 CCGGGACCTGTATCCCAACCTGG - Exonic
996761111 5:126986762-126986784 GAGGCACCTGTATGAAAAACTGG + Intronic
999122447 5:149219616-149219638 CAGGGACCTGAATATCAGGCAGG - Intronic
999643182 5:153692146-153692168 CTGAGACCTGAATGACAAGGAGG - Intronic
1000285263 5:159821016-159821038 CAGGGATCTGCATGGAAAGCCGG - Intergenic
1000915449 5:167075589-167075611 CAGTGACCTGGCTGACAAGCTGG + Intergenic
1001675228 5:173506900-173506922 CTGGGAGCTGAATGACAAACAGG - Intergenic
1003980757 6:11387757-11387779 CAGGAACCTGGATGATAAACCGG + Intergenic
1004462278 6:15848757-15848779 CGGAGACCTGGATGACAAGAAGG - Intergenic
1005283365 6:24298764-24298786 CAGGTAACAGTATGACAAACAGG + Intronic
1007290825 6:40785344-40785366 CTGGAACCTGAATGACGAGCAGG - Intergenic
1008429409 6:51398186-51398208 AAGGGCCCTGTGTGTCAAGCTGG - Intergenic
1012445800 6:99306103-99306125 CAGAGACATGAATGTCAAGCAGG + Intronic
1015201282 6:130584201-130584223 CAGGGATTTGTGTGACAAGAAGG + Intergenic
1016428108 6:143955738-143955760 CAGGGACGTATAAGACATGCTGG + Intronic
1016589891 6:145733013-145733035 CAGAGAGCTTTATGAGAAGCAGG - Intronic
1021083029 7:16386030-16386052 CAGGGACCTGGATACCAAGAGGG - Intronic
1021755047 7:23843461-23843483 CAGGGACCTGTAGGGAAGGCAGG - Intergenic
1023592514 7:41794868-41794890 CAGGGTCCTGAAAGACAGGCCGG - Intergenic
1023830271 7:44035086-44035108 CAGGGACATGTGGGACAAGTAGG - Intergenic
1028435255 7:90795880-90795902 GAAGGACCAGTGTGACAAGCAGG + Intronic
1034470812 7:151253428-151253450 CAGGGTCCTGTGTGGCAGGCAGG + Intronic
1035095596 7:156352212-156352234 CAGTGACCAGGATGACAAGAAGG - Intergenic
1036650144 8:10636902-10636924 CAGGGAGCTGTGTGACAGACTGG - Intronic
1037720187 8:21437182-21437204 CAGGGACCTGGATGCAAACCTGG + Intergenic
1037883096 8:22582324-22582346 CAGGGACCTGAATGACATGAAGG - Intronic
1041201354 8:55453846-55453868 CACGGACCTGTTTGATGAGCTGG - Intronic
1041311080 8:56517110-56517132 AAGGGAACTGTATATCAAGCAGG - Intergenic
1041814937 8:61959625-61959647 CAGGGACCTGGAAGAAAAGTAGG + Intergenic
1043293117 8:78628680-78628702 AAGGGACCTCTCTGACAAGCGGG + Intergenic
1043529667 8:81135393-81135415 CTGGGACCTGAATGACAAGAAGG - Intergenic
1043570183 8:81594363-81594385 CAGGGTCCTGGATGCCAGGCTGG - Intergenic
1047927273 8:129693798-129693820 CTGGGACCTGAATGATGAGCAGG - Intergenic
1050287403 9:4117935-4117957 CAGCGCCCTGTACGACCAGCAGG - Exonic
1052854611 9:33399466-33399488 CAGGCACCTGTAATACCAGCTGG + Intronic
1054902462 9:70383554-70383576 CTGGGACCTAGATGACAAGAAGG - Intergenic
1056745355 9:89296662-89296684 CAAGGACCTGGATGGCAGGCCGG - Intergenic
1061563625 9:131422688-131422710 CAGGAACCTGTTGGACAGGCGGG + Intronic
1187260630 X:17682300-17682322 CAGGGACCTGGAGAACAAACTGG + Intronic
1187998311 X:24953489-24953511 CTGAGACCTGAATGACAAGAGGG + Intronic
1188609557 X:32079256-32079278 CAGAGATCTGAATGACAAGAAGG - Intronic
1188695183 X:33181430-33181452 CAGGTAACTATAGGACAAGCTGG + Intronic
1192223342 X:69212095-69212117 CTGGGACCTGTATGATGAGTAGG - Intergenic
1193337982 X:80313153-80313175 CAAGGACCTGGATGGCAGGCCGG - Intergenic
1195174234 X:102299370-102299392 CAGGCAAGTGTATGACATGCTGG - Intergenic
1195184631 X:102387723-102387745 CAGGCAAGTGTATGACATGCTGG + Intronic
1195468270 X:105205178-105205200 CTGAGACCTGAATGACAAGAAGG + Intronic
1196440081 X:115711513-115711535 CAAGGACCTTTTTGAGAAGCTGG - Intergenic
1200630179 Y:5573893-5573915 CCGGGCCCAATATGACAAGCTGG + Intronic