ID: 1078023578

View in Genome Browser
Species Human (GRCh38)
Location 11:7673915-7673937
Sequence CCCCGAGAAGGGCCGTGGTC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 111
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 102}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078023570_1078023578 -6 Left 1078023570 11:7673898-7673920 CCGGCGGCTGGCCCGCTCCCCGA 0: 1
1: 0
2: 0
3: 13
4: 146
Right 1078023578 11:7673915-7673937 CCCCGAGAAGGGCCGTGGTCGGG 0: 1
1: 0
2: 0
3: 8
4: 102
1078023568_1078023578 -4 Left 1078023568 11:7673896-7673918 CCCCGGCGGCTGGCCCGCTCCCC 0: 1
1: 0
2: 1
3: 32
4: 358
Right 1078023578 11:7673915-7673937 CCCCGAGAAGGGCCGTGGTCGGG 0: 1
1: 0
2: 0
3: 8
4: 102
1078023563_1078023578 11 Left 1078023563 11:7673881-7673903 CCCCGCAGGCTGGGACCCCGGCG 0: 1
1: 0
2: 0
3: 17
4: 152
Right 1078023578 11:7673915-7673937 CCCCGAGAAGGGCCGTGGTCGGG 0: 1
1: 0
2: 0
3: 8
4: 102
1078023564_1078023578 10 Left 1078023564 11:7673882-7673904 CCCGCAGGCTGGGACCCCGGCGG 0: 1
1: 0
2: 2
3: 19
4: 254
Right 1078023578 11:7673915-7673937 CCCCGAGAAGGGCCGTGGTCGGG 0: 1
1: 0
2: 0
3: 8
4: 102
1078023566_1078023578 9 Left 1078023566 11:7673883-7673905 CCGCAGGCTGGGACCCCGGCGGC 0: 1
1: 0
2: 1
3: 28
4: 261
Right 1078023578 11:7673915-7673937 CCCCGAGAAGGGCCGTGGTCGGG 0: 1
1: 0
2: 0
3: 8
4: 102
1078023569_1078023578 -5 Left 1078023569 11:7673897-7673919 CCCGGCGGCTGGCCCGCTCCCCG 0: 1
1: 0
2: 2
3: 16
4: 250
Right 1078023578 11:7673915-7673937 CCCCGAGAAGGGCCGTGGTCGGG 0: 1
1: 0
2: 0
3: 8
4: 102

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078023578 Original CRISPR CCCCGAGAAGGGCCGTGGTC GGG Exonic
900373468 1:2342780-2342802 CACCGAGAAGGGACCTGGGCTGG + Intronic
900864137 1:5255224-5255246 CCCAGAGAAGGCCTGTGGTGGGG + Intergenic
900929661 1:5728539-5728561 CCCCGAGAGGGGCCGAGGGAGGG + Intergenic
900974128 1:6006782-6006804 CCCAGAGGAGGGATGTGGTCAGG - Intronic
902127504 1:14228513-14228535 CTCAGAGAAGGGCCATGGGCAGG + Intergenic
902399820 1:16151733-16151755 CCCCTGGCAGGGCAGTGGTCAGG - Intronic
904171052 1:28592444-28592466 CCCCGGGCAGGGGCGGGGTCGGG + Intronic
907237654 1:53062794-53062816 CCCAGAGAGGGGCAGAGGTCTGG + Intronic
914431023 1:147620249-147620271 CCCACAGATGGGCCCTGGTCGGG + Exonic
914688240 1:150001757-150001779 CCCAGAGAAGGGCCTTGGTTTGG - Intronic
919958103 1:202438927-202438949 CCCCGAAGACGGCCGTGGACTGG + Intronic
923113454 1:230912072-230912094 CACAGAGAAGGGGCGTGGTGGGG + Intronic
1067110642 10:43397208-43397230 CCCCGAGGAGGCGCGGGGTCCGG + Intronic
1070540297 10:77410749-77410771 CCCCGAGACGGGACTGGGTCTGG - Intronic
1076055368 10:127368101-127368123 CCCTGTGAAGGGCCATGTTCTGG - Intronic
1076620813 10:131786192-131786214 CCCTGAGCAGAGCCGTGGGCTGG - Intergenic
1077216803 11:1398425-1398447 CCCCGGGAAGGGTGGTGGCCAGG + Intronic
1078023578 11:7673915-7673937 CCCCGAGAAGGGCCGTGGTCGGG + Exonic
1083482343 11:62957665-62957687 CCCTGAGAAGGGCTGCAGTCAGG - Intronic
1083629398 11:64087988-64088010 CCTCGAGAGGGGCTGTGGTGTGG + Intronic
1083934609 11:65863718-65863740 CCAGGTGAAGGGCCGTGGACAGG + Exonic
1084180402 11:67443127-67443149 CCCCAGGAAGGGACGGGGTCGGG + Intronic
1084312505 11:68325118-68325140 TACCCAGAAGGGCCTTGGTCAGG - Intronic
1084891651 11:72239806-72239828 CCCGGAGAAGGGCCCGGGGCCGG + Exonic
1086402643 11:86473217-86473239 CCACGCAATGGGCCGTGGTCGGG + Intronic
1090806566 11:130206269-130206291 CCCCGTGAAGGGGGCTGGTCGGG + Intronic
1091737432 12:2934495-2934517 CCCCATGAAGGGCCGGGGTTTGG + Exonic
1092215527 12:6679117-6679139 GCCAGAGAAGGGCTGTGGTCTGG - Exonic
1097070382 12:56350123-56350145 CCCCGAGAAGGGGCAGAGTCAGG - Exonic
1102012565 12:109627656-109627678 CCCCTGGAAGGGCCTTGGTGAGG - Intergenic
1102502793 12:113364181-113364203 CCCGGAGACGGGCAGTGGTTAGG - Intronic
1118363864 14:65077649-65077671 CCCCAAGAAGGGGAGAGGTCAGG + Intronic
1120787563 14:88551263-88551285 CCTGGAGAGGGGCCGGGGTCTGG - Intronic
1121833264 14:97069875-97069897 CCATGAGATGGGCAGTGGTCTGG + Intergenic
1122066051 14:99175119-99175141 CCGCGAGAACGGCGGTGGTGGGG - Exonic
1122154777 14:99743410-99743432 CTGTGAGAAGGGCAGTGGTCTGG - Intronic
1122981505 14:105194255-105194277 TCCCAGGAAGGGCAGTGGTCTGG - Intergenic
1125503070 15:40251692-40251714 CCCAGAGAAAGGCTGTGTTCTGG - Exonic
1128321146 15:66695221-66695243 CCTCCAGGAGGGCCGAGGTCAGG + Intergenic
1132847005 16:2005303-2005325 CCCCGAGGAGGCTCGTGCTCTGG - Intronic
1132933813 16:2471358-2471380 TCCCGGGAAGGGCCGTGGGCGGG - Intergenic
1136560174 16:31034300-31034322 CCTCGGGAAGGGGCGTGGCCAGG - Exonic
1137664965 16:50244784-50244806 CCCCGTGGAGGGCCCTGGCCGGG - Intergenic
1141669684 16:85485275-85485297 CCCAGAGAATGGCGTTGGTCCGG + Intergenic
1142119847 16:88381893-88381915 CCACCAGAAGGCCCGTGGTTAGG + Intergenic
1142151731 16:88515499-88515521 CCCTGAGAGGGGGCGTGGGCAGG + Intronic
1142256597 16:89017035-89017057 CCCAGAGATGGGCCCTGCTCAGG + Intergenic
1148164756 17:45475554-45475576 CCCGGAGCAGGGCGGTGGGCTGG + Exonic
1150395975 17:64822221-64822243 CCCGGAGCAGGGCGGTGGGCTGG + Intergenic
1152087695 17:78230771-78230793 CCCAGAGAGGGGCTGTGGTCAGG + Intergenic
1152644457 17:81462393-81462415 CCCCGAGCAGTGCCCTGGTGAGG - Intronic
1156880303 18:42069520-42069542 CACAGAGATGGGCCGTGGCCAGG - Intronic
1160163352 18:76491622-76491644 CCAGGAGGAGGGCCGTGGGCGGG - Intronic
1160659034 19:289900-289922 GCCCGATAAGAGCTGTGGTCGGG - Intronic
1160745309 19:708744-708766 CCCTGAGAAGGGCCTAGGTCTGG - Intergenic
1160824158 19:1071604-1071626 TCCCGAGAAGGGGCGTGGCCGGG + Intronic
1167679309 19:50909590-50909612 TACCGAGCAGGGGCGTGGTCAGG + Intronic
925054042 2:842341-842363 CCCTGAGCAGGGCCGTGGGTGGG + Intergenic
929452776 2:42048045-42048067 GCCCGCGAGGGGCCGGGGTCGGG + Exonic
930640944 2:53853995-53854017 CCCCATGAAAGGCTGTGGTCTGG + Exonic
931763475 2:65435803-65435825 CCGCGGGAAGGGCCGGGGTGGGG - Intergenic
932338158 2:70942831-70942853 CTCAGAGAAGGGCACTGGTCAGG + Intronic
934991923 2:98927752-98927774 CCCAGAGAAGGCTCGTGGACTGG + Intronic
941095707 2:161238026-161238048 CCCCGAGTCGGGCCGTGCTTCGG + Intergenic
946354484 2:219176551-219176573 CTCCGAGAAGGGCCCTCGTGTGG + Intronic
946394191 2:219435045-219435067 CCCCGAAAAGGGCCAAGGTGGGG + Exonic
948086955 2:235258709-235258731 CCTGGAGAAGGGGCGTGGGCAGG - Intergenic
1171982486 20:31637843-31637865 CCCCGAGAAAGGCTGTGGGGCGG + Intergenic
1173566155 20:44039935-44039957 CCCCGAGGTGGGCCGAGGGCCGG + Intronic
1174579854 20:51563722-51563744 CCCCCAGAAGGTCCGTGGGGAGG + Intergenic
1175425605 20:58863964-58863986 ACCCAAGAAGGGCCATGGACAGG + Intronic
1179184696 21:39076157-39076179 CCCCGAGCAAAGCCGTTGTCTGG - Intergenic
1181976653 22:26735756-26735778 CCCAGAGAAGAGCCTTGATCAGG + Intergenic
1183742647 22:39677430-39677452 CCCAGAGCAGGCCCGTGGTGGGG + Intronic
1184417632 22:44361436-44361458 CCCTGAGAAGGGCAGGGGTAAGG + Intergenic
1184650520 22:45917501-45917523 CCTTGGGAGGGGCCGTGGTCAGG - Intergenic
1185101980 22:48845450-48845472 CCCTGCGAGGGGCCGGGGTCGGG + Intronic
949987791 3:9553588-9553610 GCCCGAGTAGGGCCGGGGTTGGG + Intronic
953564715 3:44021779-44021801 CCCCGGGCAGGGCCGGAGTCTGG - Intergenic
954035979 3:47851422-47851444 ACCAGAGAAGGGCAGAGGTCAGG + Intronic
959592078 3:108091612-108091634 CCCAGGGCAGGGCGGTGGTCGGG + Intergenic
961368566 3:126416116-126416138 CCCCGAGAAGGGCGCCAGTCAGG - Intronic
962259576 3:133894491-133894513 CCCCAAGAAGGGCGGTGAGCTGG + Intronic
962286882 3:134093694-134093716 CCCCAACAAGGGCCTTGTTCAGG + Intronic
964210509 3:154221789-154221811 ACCCGTGAGGGGCAGTGGTCAGG + Intronic
967148488 3:186626773-186626795 CCCCGATAAGGCATGTGGTCTGG - Intergenic
968470703 4:781200-781222 CCCCGGGAAAGGCTGTGGCCTGG - Intergenic
968513225 4:1004311-1004333 GTCCGAGAAGGGGCCTGGTCGGG - Exonic
983937127 4:173509718-173509740 CCCCGAGAAGGGCCCTGGGGTGG - Intergenic
985705853 5:1400944-1400966 ACCCGAGAAGGACCGTGAGCTGG - Exonic
987042578 5:14076867-14076889 CCCCAGGAAGGGACGTGGCCAGG - Intergenic
996862738 5:128083989-128084011 CCCCGGGACTGGCCGGGGTCGGG + Exonic
1007651902 6:43427818-43427840 CCGCGAGAATGGGCGGGGTCTGG + Intronic
1010926536 6:81752290-81752312 CTCCGAGGAGGCCCGGGGTCAGG - Intronic
1015842294 6:137488724-137488746 CCCCGAGACAGTCCGGGGTCAGG + Intergenic
1022711671 7:32856542-32856564 CCCACAGAAGGGCAGTGGGCAGG - Intergenic
1022912987 7:34918417-34918439 CCCACAGAAGGGCAGTGGGCAGG + Intergenic
1026848086 7:73708757-73708779 CCCAGAGTAGGGCTGCGGTCAGG + Intronic
1029671278 7:102032983-102033005 CCCTGAGAAGGGGCGTGTTATGG + Intronic
1033032781 7:137844032-137844054 CCCCCAGAAGGGAGGTGGTGTGG + Intronic
1047744861 8:127837160-127837182 CCCAGAGAAGGGCCATGGGTGGG + Intergenic
1048223906 8:132566718-132566740 GCCAGAGAAGGGCCGTGCTGGGG - Intergenic
1049515221 8:143050902-143050924 CCCCGAGCCGGGCCCTGGTCAGG - Intronic
1060514644 9:124258129-124258151 CCCGGAGAAGGGCGGGGGCCGGG + Intronic
1061304876 9:129726444-129726466 CCCCGAGAAGTGCCTTGTCCAGG - Intergenic
1061671147 9:132188834-132188856 CCCTGAGGAGGGCCGGGGGCTGG + Intronic
1062230804 9:135480327-135480349 CTCCGAGAATGGCCGCGGCCCGG + Intronic
1062490034 9:136800506-136800528 GCCCGGGAAGGGCGGGGGTCAGG + Exonic
1203781357 EBV:102743-102765 CCTTGAGAGGGGCCGTGTTCAGG - Intergenic
1185498513 X:578681-578703 CCCCGAGAAAGACCTGGGTCTGG + Intergenic
1187535891 X:20141584-20141606 GGCCGAGCAGAGCCGTGGTCCGG + Intronic