ID: 1078024449

View in Genome Browser
Species Human (GRCh38)
Location 11:7681388-7681410
Sequence GAGTGCACAAGGTTTTCCAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078024449_1078024454 -10 Left 1078024449 11:7681388-7681410 CCCATGGAAAACCTTGTGCACTC No data
Right 1078024454 11:7681401-7681423 TTGTGCACTCCTGGCAACGTGGG No data
1078024449_1078024455 -9 Left 1078024449 11:7681388-7681410 CCCATGGAAAACCTTGTGCACTC No data
Right 1078024455 11:7681402-7681424 TGTGCACTCCTGGCAACGTGGGG No data
1078024449_1078024459 21 Left 1078024449 11:7681388-7681410 CCCATGGAAAACCTTGTGCACTC No data
Right 1078024459 11:7681432-7681454 GGGCATGATAGACTGTATAAAGG No data
1078024449_1078024457 0 Left 1078024449 11:7681388-7681410 CCCATGGAAAACCTTGTGCACTC No data
Right 1078024457 11:7681411-7681433 CTGGCAACGTGGGGCTAACATGG No data
1078024449_1078024458 1 Left 1078024449 11:7681388-7681410 CCCATGGAAAACCTTGTGCACTC No data
Right 1078024458 11:7681412-7681434 TGGCAACGTGGGGCTAACATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078024449 Original CRISPR GAGTGCACAAGGTTTTCCAT GGG (reversed) Intergenic
No off target data available for this crispr