ID: 1078025891

View in Genome Browser
Species Human (GRCh38)
Location 11:7695389-7695411
Sequence CAGGGTGAACTCAGGGTTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 245
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 223}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078025885_1078025891 16 Left 1078025885 11:7695350-7695372 CCTCTCGACTCACTTGGAGGGGC 0: 1
1: 0
2: 0
3: 2
4: 58
Right 1078025891 11:7695389-7695411 CAGGGTGAACTCAGGGTTGAGGG 0: 1
1: 0
2: 0
3: 21
4: 223
1078025883_1078025891 17 Left 1078025883 11:7695349-7695371 CCCTCTCGACTCACTTGGAGGGG 0: 1
1: 0
2: 0
3: 8
4: 108
Right 1078025891 11:7695389-7695411 CAGGGTGAACTCAGGGTTGAGGG 0: 1
1: 0
2: 0
3: 21
4: 223

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078025891 Original CRISPR CAGGGTGAACTCAGGGTTGA GGG Intronic
900133627 1:1103561-1103583 CAGGGTGCACGCAGGGGTCAGGG + Intronic
900279643 1:1858424-1858446 CAGGAAGAACCCAGGGATGAGGG - Intronic
900335149 1:2159115-2159137 CGGGGTGAGCTCCGGGTTGGGGG + Intronic
900427185 1:2586222-2586244 TGGGCTGGACTCAGGGTTGAGGG - Intergenic
901306206 1:8234846-8234868 CAAGGTGAAGACAGTGTTGATGG + Intergenic
901436731 1:9251141-9251163 CAGGGTCATCTCTGGGATGAAGG - Intronic
904424667 1:30415662-30415684 CAGGGTGGAATCAGGGCTGGAGG + Intergenic
904459509 1:30667824-30667846 CAGGATTAACACAGGGTTGCTGG - Intergenic
905481274 1:38263820-38263842 CACTGAGAACTCAGGGTTGGAGG - Intergenic
908657951 1:66407538-66407560 CTGGGGGATCTCTGGGTTGAAGG - Intergenic
912312070 1:108632882-108632904 CAGGCTGAGCCCGGGGTTGAAGG - Intronic
916140293 1:161691498-161691520 CATGGTGAGCTGAGAGTTGAAGG + Intergenic
916261996 1:162851453-162851475 CAGGGTGAAATGAGCCTTGAAGG - Intronic
920366356 1:205450151-205450173 CAGGCCCAAGTCAGGGTTGAAGG - Intronic
920866295 1:209756680-209756702 CAGTGTGAACTGAGGGGAGAGGG - Intronic
922565284 1:226597584-226597606 AAGGGGAAACTCAGGGTTCAGGG + Intronic
922806977 1:228395206-228395228 CAGGATCAGCTCAGGGTTGGCGG + Exonic
923803145 1:237229853-237229875 CAGAGTGGACGCAGGGTTGGTGG - Intronic
924367714 1:243313571-243313593 CAGGGTTAACACAGTGTTGCTGG + Intronic
924879527 1:248145167-248145189 GAGGATGAAGTCAGAGTTGAAGG - Exonic
1068398700 10:56499669-56499691 CAGTGTGAACACAGAGTTGCAGG + Intergenic
1070502652 10:77086326-77086348 AAGGGTGACCTCAAGGTTGCTGG + Intronic
1072719182 10:97770512-97770534 CAGGGAGAAATTAGGGTTCAGGG + Intronic
1073422372 10:103434644-103434666 CAGGGTGATCTCAGTCTAGATGG + Intronic
1073577412 10:104638479-104638501 CAGGGGCAGCTCAGGGCTGAGGG + Intergenic
1074053411 10:109900274-109900296 CAGGGTAGATTCTGGGTTGATGG - Intronic
1075157409 10:119989550-119989572 CAGGGTGATCTCTGGGTAGGTGG + Intergenic
1075403474 10:122177894-122177916 CAGGGTAAATCCAGGGTTCAGGG - Intronic
1075494835 10:122911097-122911119 CTGGGTTATCTCAGGGTTTAAGG - Intronic
1076479759 10:130777468-130777490 TAGGGTGCACTCAGGGAAGATGG - Intergenic
1076848394 10:133081151-133081173 CAGGTTGAGATCAGGGTAGATGG + Intronic
1077487992 11:2847912-2847934 CAGGAAGAGCTCAGGGTCGACGG - Exonic
1077793111 11:5462355-5462377 CTGTGTGAACTCAGGGAAGAGGG + Intronic
1078025891 11:7695389-7695411 CAGGGTGAACTCAGGGTTGAGGG + Intronic
1079454133 11:20622650-20622672 CAGAGGGAACTCAGGAGTGATGG + Intronic
1083712301 11:64556701-64556723 CAGGGGGAAATCAGGGGTAAGGG + Intronic
1083934283 11:65862276-65862298 CAGGGTGAGCACAGGGATCAGGG + Exonic
1085768219 11:79302680-79302702 CAAGGTGAACTCAGGGAACAGGG - Intronic
1088900032 11:114108897-114108919 CAGGCTGGCCTCAGTGTTGATGG + Intronic
1089248252 11:117137978-117138000 CAGGGTGACCTGCGGGGTGAAGG + Intergenic
1089258459 11:117206583-117206605 CAGGGTGACCTGCGGGGTGAAGG - Intronic
1089454591 11:118618589-118618611 AGGGGTGAACTCAGGACTGATGG + Intronic
1089761354 11:120726432-120726454 CAGGGTAAAAGCAGTGTTGATGG + Intronic
1089898603 11:121957686-121957708 TAGGGAGAGCTCAGGGGTGACGG - Intergenic
1090499226 11:127245351-127245373 CAAGGAGAATTCAGGGCTGAGGG + Intergenic
1091773520 12:3169242-3169264 CAGGTTGACCTCAGGGCTGGGGG + Intronic
1095527663 12:43147103-43147125 CAGGGTGGTCTCAGGGTAGGTGG + Intergenic
1096539244 12:52295553-52295575 CAGGTTGCTCTCAGGGTTCAGGG + Intronic
1096560815 12:52434467-52434489 GAGTGTGAGCTCAGGGTTGGCGG - Exonic
1097808176 12:63988421-63988443 AAGGGAGATCTCAGGGTAGAGGG + Intronic
1097808636 12:63993065-63993087 CAGGGAGAAATCAGAGTTTACGG + Intronic
1098540900 12:71656106-71656128 CCAGGTGAACTAAGGGCTGAGGG + Intronic
1100684146 12:96967271-96967293 CAGGGTGAACTAGAGGTAGAAGG - Intergenic
1100778781 12:98001512-98001534 CAGCAGGGACTCAGGGTTGAAGG - Intergenic
1104949773 12:132434170-132434192 CAGGGTCAACTCATGCCTGACGG - Intergenic
1105587277 13:21756858-21756880 CAGGGTGAAGTCAGGGGGCAGGG - Intergenic
1106123076 13:26878010-26878032 CAGGGTGAACTGAATGGTGAAGG + Intergenic
1106679630 13:31996882-31996904 TAGGGGGAAGTCATGGTTGAGGG - Intergenic
1107664821 13:42677841-42677863 CAGGGTGAAGTCATGGGGGAGGG + Intergenic
1109034713 13:57241701-57241723 CAGCTTGTACTCATGGTTGAAGG + Intergenic
1110880640 13:80568103-80568125 CAGGGTGAAGTGAGTCTTGAAGG - Intergenic
1112405701 13:99118353-99118375 CAGGGTGATCTCAGGGTAGTTGG + Intergenic
1114375675 14:22144068-22144090 CAGGGTGGACTCAGAGTGGAAGG + Intergenic
1115179882 14:30611227-30611249 CAGCTGAAACTCAGGGTTGAGGG + Intronic
1116400148 14:44496826-44496848 CTGGCTGAACTAAGAGTTGAAGG + Intergenic
1116858755 14:49977089-49977111 CATGGTGATCTCAGGGTAGTTGG + Intergenic
1118600810 14:67470463-67470485 CTGGGTGGCCTCAGGGTGGAAGG + Exonic
1119348837 14:73947792-73947814 CACAGGGAACTTAGGGTTGAGGG + Intronic
1119424572 14:74527384-74527406 CAGCGTGAGCTCAGGGAGGAGGG + Intronic
1119477297 14:74938389-74938411 CATGGTGACCTCAGGGTAGTTGG + Intergenic
1120625604 14:86821995-86822017 CTGATTGACCTCAGGGTTGAGGG + Intergenic
1122211105 14:100174761-100174783 CAGCGTGGAGTCAGGGTTGGAGG - Intergenic
1122687719 14:103518013-103518035 CGAGGTGAACACAGGGCTGAGGG - Intergenic
1125116715 15:36101922-36101944 CAGGATGCACTCAGGGTTTCTGG - Intergenic
1125122062 15:36172983-36173005 CTGGGGGAAATTAGGGTTGAGGG - Intergenic
1125601053 15:40915975-40915997 CAGTGTGCAGCCAGGGTTGAGGG - Intergenic
1125749761 15:42020398-42020420 CAGGGAGACCTCTGGGTTCATGG - Intronic
1128231394 15:66037902-66037924 CATGGGGATGTCAGGGTTGAGGG - Intronic
1128897325 15:71387265-71387287 CTGGGTGAACTCAGGTGTTAGGG + Intronic
1129740332 15:77986793-77986815 CAGGGGCACCTCAGGGCTGAGGG - Intronic
1129845420 15:78765804-78765826 CAGGGGCACCTCAGGGCTGAGGG + Exonic
1130253459 15:82315218-82315240 CTGGGTGGACTCAGGGTAGGTGG - Intergenic
1130256428 15:82328055-82328077 CAGGGGCACCTCAGGGCTGAGGG - Intergenic
1130598524 15:85261933-85261955 CAGGGGCACCTCAGGGCTGAGGG + Intergenic
1132328115 15:100988823-100988845 CAGGGTTGACTCAGGGTAGTGGG - Intronic
1133209026 16:4252743-4252765 CAGGGAGAAGTCTGGGTTGGTGG - Intergenic
1133423999 16:5671846-5671868 CAGTGTGAGCTGGGGGTTGAAGG + Intergenic
1134452794 16:14373690-14373712 CAGGCTGGGCTCAGGGTTCACGG - Intergenic
1136706255 16:32190317-32190339 CAGGGTGAAGTCAGGTTTGTTGG - Intergenic
1136761655 16:32739094-32739116 CAGGGTGAAGTCAGGTTTGTTGG + Intergenic
1136806445 16:33131296-33131318 CAGGGTGAAGTCAGGTTTGTTGG - Intergenic
1138564176 16:57820579-57820601 CAGAGTGATCTTAGAGTTGATGG + Intronic
1138676144 16:58652953-58652975 CAGGGTGAACGCTAGGTTGCAGG + Intergenic
1139072553 16:63401037-63401059 CAGGGTTAACTAAGAGTGGAAGG + Intergenic
1139265569 16:65635463-65635485 CAGGGGGAACACAGGGTAGGTGG - Intergenic
1139405202 16:66712511-66712533 CAGTGTGAACTCATGGTTTTGGG - Intergenic
1139660765 16:68419244-68419266 CAGGAAGAAGTCAAGGTTGATGG + Intronic
1141073074 16:80975872-80975894 CATGGTGAAGTCAGGTTTGCTGG + Exonic
1141163913 16:81647816-81647838 CAGGGTGGCCACAGGGATGAGGG - Intronic
1141244528 16:82293564-82293586 CAGGGGGATCATAGGGTTGAAGG + Intergenic
1203063812 16_KI270728v1_random:999407-999429 CAGGGTGAAGTCAGGTTTGTTGG + Intergenic
1143743058 17:8967730-8967752 CAGACAGAACTCAGTGTTGACGG - Intergenic
1143757246 17:9075971-9075993 AAGGGTGAACCTGGGGTTGAGGG - Intronic
1143782721 17:9237848-9237870 CAGTGTGAACTCTGGGTGGGGGG - Intronic
1144232346 17:13220700-13220722 CAGGGTGAAGGCAAGGTAGATGG + Intergenic
1145980796 17:29010268-29010290 CAGGAAGAGCTCAGGGTAGATGG + Intronic
1146053851 17:29571685-29571707 GAGGCTGAAGTCAGGGGTGAGGG - Exonic
1147948114 17:44091935-44091957 CAGTGGGAGCTCAGGGTAGAGGG - Intronic
1148050963 17:44769755-44769777 CAGGGTGAAGTTTGAGTTGAAGG - Exonic
1150103969 17:62448109-62448131 CAGGGTGAACCCTGGGTTCTAGG + Intronic
1151445962 17:74164205-74164227 CATGGGGAAGTCAGGGTAGAGGG - Intergenic
1154004176 18:10512670-10512692 CAGGGAGAACTCAGGAGAGAGGG - Intergenic
1157247867 18:46070331-46070353 CAGGGTGAAGACAGGGTTCCAGG - Intronic
1157546323 18:48549146-48549168 CAGGGTGCACATAGGGGTGATGG + Intronic
1158393507 18:57062327-57062349 AGGGGTGAACTCAGGGTTAAGGG - Intergenic
1158396918 18:57086445-57086467 CAGGGTGAAATCATGGGTCAGGG + Intergenic
1159560062 18:69984201-69984223 CAGGGAGAACTCAGGATTTGGGG - Intergenic
1160448129 18:78942792-78942814 AAGGGAGAACTCAGGTTTGCAGG - Intergenic
1162057176 19:8071685-8071707 CAGGGTGCAGGCAGGGTTGGAGG + Intronic
1164798191 19:31053485-31053507 TGGGGTGATCTCAGGGTTTATGG + Intergenic
1165020556 19:32920815-32920837 CTGGGTGACCTCAGGCTTAATGG - Intronic
1166813486 19:45527913-45527935 CAGGGGGACCTCTGGGCTGAGGG + Exonic
1166948799 19:46413018-46413040 CAGGGTGATATCTGGGGTGAGGG + Exonic
1168129135 19:54306250-54306272 CAGGGTCATCCCTGGGTTGAGGG - Intergenic
1168284287 19:55322688-55322710 CTGGGTGAGCTCAGGGAAGAAGG + Exonic
925781081 2:7382437-7382459 CAAGGAGAACTCAGGGGTGAGGG - Intergenic
929928260 2:46232840-46232862 CAGGGTGAAATGGGGGTGGAGGG - Intergenic
930920250 2:56744512-56744534 CAGTGTGCACCCAAGGTTGAAGG - Intergenic
932020205 2:68076985-68077007 AAGGCTGAAGTCAGGGTGGAGGG + Intronic
933355400 2:81203654-81203676 AAGGGAGAAGTCAGGGATGATGG - Intergenic
934952696 2:98589179-98589201 CACAGTGAACTCAGCTTTGAGGG - Exonic
935126311 2:100226579-100226601 CAGGGGGATCCCAGTGTTGAGGG - Intergenic
935148717 2:100414479-100414501 CAGAATGTGCTCAGGGTTGATGG - Intronic
937849807 2:126621966-126621988 AAGAGTGAACTCTGGGTTGCAGG + Intergenic
938201428 2:129376026-129376048 AAGGCTGAACACAGGGCTGAGGG - Intergenic
938804404 2:134792726-134792748 CATGATGAACACAGAGTTGATGG + Intergenic
938932690 2:136100584-136100606 CACGCTGAACACAGGGATGAAGG + Intergenic
940993659 2:160123431-160123453 AAGGGTGAATTCAGGTTTGGGGG + Intronic
942237057 2:173920985-173921007 CAGGGAGATTTCAGGGTTGCTGG + Intronic
944107688 2:196097134-196097156 CAGCATGAACTCAGGTATGATGG - Intergenic
945401646 2:209389502-209389524 CAGGAGGAAATCAGGGCTGAAGG + Intergenic
946716224 2:222556942-222556964 CAGGGAGAAGTCAGGGTGGATGG - Intronic
946789290 2:223284506-223284528 TGGGGTGAAATCAGGGTGGATGG + Intergenic
1170938122 20:20827198-20827220 CAGTGGGAACTCAGGGAAGAGGG + Intergenic
1171993277 20:31713075-31713097 CTAGGGGAACTCAGGGTTAATGG + Intronic
1172225569 20:33303046-33303068 CAGGGTGAACAAAGGGCGGAGGG - Exonic
1172803552 20:37595414-37595436 AAGGGAGCCCTCAGGGTTGATGG - Intergenic
1173946801 20:46957973-46957995 CAGAGTGAACTCTGAGTGGATGG - Intronic
1174537141 20:51260030-51260052 CAGGGTGAAGTCATGGGTGAGGG - Intergenic
1175797507 20:61781303-61781325 CTGGGTGATCTCAGGGTTCCTGG - Intronic
1175852963 20:62103783-62103805 CAGGGTGGACCCAGGGTGGCAGG + Intergenic
1177286972 21:19064375-19064397 GAGGGTGAACTCAGGTCAGATGG + Intergenic
1177865366 21:26506594-26506616 CAGAGTGAACTCAGTGTTTTTGG + Intronic
1181033426 22:20158822-20158844 CTAGGTGAACTCAGGGTCAAGGG - Intergenic
1181313345 22:21957201-21957223 CAGGGAGAAGGCAGGGTCGAGGG - Exonic
1181346450 22:22223273-22223295 CAGGGAGAAGGCAGGGTCGAGGG - Intergenic
1181416343 22:22762183-22762205 TAGGCTGAGCTCAGGGTTCAGGG - Intronic
1181484736 22:23223601-23223623 CAGGGGGTACTCAGGGAGGAGGG + Intronic
1181495356 22:23284490-23284512 CTGGGTGAACCCAGGGAGGAGGG - Intronic
1181511556 22:23391492-23391514 GAGGGTTAACTGAGGGCTGAGGG + Intergenic
1182781172 22:32869098-32869120 CAGGATGAAGTCTGGCTTGAAGG + Exonic
1183467099 22:37985296-37985318 CAGGGTGAGCCCAGTGTGGAAGG - Intronic
1184176409 22:42791968-42791990 CAGGGGCACCTCAGGGCTGAGGG + Intergenic
1184217140 22:43075279-43075301 CAGGGTGAACACAGTGATGTGGG + Intronic
1184218083 22:43080607-43080629 CAGGGTGCACACAGGCTTGCAGG - Intronic
1184279393 22:43428394-43428416 CAGGGTGGGCACAGGGATGAGGG + Intronic
1185416988 22:50715808-50715830 CAGGGTGGACTTGGGTTTGAAGG + Intergenic
950548218 3:13651656-13651678 CAGGCTGAACACAGGGCTGTAGG - Intergenic
953442947 3:42935430-42935452 CAGGGTGAATTCAGGGCTCTGGG + Intronic
954194095 3:48985924-48985946 CAGGGTGAACTCCAGCTTCACGG + Exonic
954724671 3:52597590-52597612 CAGGGTTCACTCAGGTTTCAGGG + Intronic
955322040 3:57981510-57981532 CAGGGAGGTCCCAGGGTTGAAGG + Intergenic
955774116 3:62415378-62415400 GAGTGTGAACTCAGGGTTCATGG - Intronic
961920818 3:130424240-130424262 CAGTGTTAACTCCAGGTTGATGG + Intronic
964116283 3:153139526-153139548 CAGGGTGGACTGAGGACTGAAGG - Intergenic
968083610 3:195863917-195863939 CCGGGTGAAGACAGGCTTGAGGG - Exonic
969571753 4:8012901-8012923 AAGGGTGAACAGAGGGTAGATGG - Intronic
970756603 4:19434599-19434621 CAGGGTAAAATGAGGGGTGAGGG - Intergenic
971068124 4:23058590-23058612 CAGGGTGGAGTGAGGGTTGAGGG + Intergenic
973331436 4:48913673-48913695 CAGCCAGAACTCTGGGTTGATGG - Intergenic
975426086 4:74229470-74229492 CTAGGAGAACTCAGGGTAGAAGG + Intronic
977736935 4:100428002-100428024 CAGGGTGATCACAGAGTAGATGG - Intronic
984370160 4:178853481-178853503 CAGGGATCTCTCAGGGTTGAAGG + Intergenic
984413484 4:179427280-179427302 CAGGGTGAACTCAAGTCTTATGG - Intergenic
986242817 5:5976641-5976663 CAGGGTGATCTCAGAGGAGAAGG + Intergenic
986703913 5:10439826-10439848 CAGGGTGAACACAGAGGTGATGG - Exonic
991447744 5:66717971-66717993 CAGTGAGAACTCAGGGATGGAGG - Intronic
997203907 5:132030271-132030293 CCGGGTGAACCCAGGGTTCAGGG + Intergenic
1002817572 6:693970-693992 CAGGGGGTTCTCAGGGTTGGGGG + Intergenic
1003165093 6:3670592-3670614 CTGGGTGGACTCAGGGCTGAGGG + Intergenic
1003337441 6:5187228-5187250 CAGGGTGAAGACAGGGTGGCTGG + Intronic
1003467997 6:6399726-6399748 CAGGGTGAACTCATGTGAGATGG - Intergenic
1004938105 6:20527989-20528011 CAGCGTGAATTCGGGGTTGTCGG - Intergenic
1006175891 6:32121287-32121309 CAGGGAGGCCTCAGAGTTGACGG + Exonic
1007991658 6:46262331-46262353 CAGGGTGAACAGGGGGCTGATGG - Intronic
1015128684 6:129785349-129785371 CTGGGTGAACTGAGGGTGGATGG + Intergenic
1015588382 6:134799499-134799521 AAGGGTGAACACAGGGTCCAGGG + Intergenic
1016313330 6:142758372-142758394 CAGGCTGAGCTCAGGATTCAGGG + Intronic
1017248429 6:152253182-152253204 TAGGGTGATCTCAGGGAAGATGG - Intronic
1018881990 6:167893152-167893174 AAGGGTGACCTAAGGGTTGGTGG + Intronic
1019157462 6:170048864-170048886 CAGGCTCAGCTCAGGGTGGAGGG + Intergenic
1019480499 7:1264582-1264604 CAGGGTGCACACAGGGTGGGTGG - Intergenic
1021806854 7:24366098-24366120 CAGGGTGAACTCAGAGAAGTAGG - Intergenic
1021968463 7:25945076-25945098 CAGGGTGTGGGCAGGGTTGAGGG - Intergenic
1023392798 7:39726567-39726589 CAGGCTGCCCTCAGGGTTGCAGG + Intergenic
1023522856 7:41066156-41066178 CAGGATGAATTTAGGGTTGTAGG + Intergenic
1023908541 7:44538560-44538582 CAGAGTGGACTCGGGGTTGAAGG + Intronic
1026315215 7:69221761-69221783 CACGGTGAAATCAGGGTGGCGGG - Intergenic
1026382630 7:69814641-69814663 CAGGCTGAAAGCAGGGTTGCAGG - Intronic
1026773613 7:73217542-73217564 CAGGGTGACCTCTGGAATGATGG - Intergenic
1027014472 7:74770936-74770958 CAGGGTGACCTCTGGAATGATGG - Intergenic
1027073561 7:75175021-75175043 CAGGGTGACCTCTGGAATGATGG + Intergenic
1029129221 7:98317584-98317606 CGGTGTGAACTGAGGGATGAGGG - Intronic
1029129320 7:98318109-98318131 CAATGTGAACTGAGGGGTGAGGG - Intronic
1029492838 7:100881740-100881762 CAGGGTGGCCCCAGGGCTGAGGG - Exonic
1032033150 7:128501306-128501328 CAGGGTGAACCCTGGGTTCTAGG + Intronic
1034827981 7:154284159-154284181 CTGGGTGAGCTCTTGGTTGAGGG + Intronic
1038570546 8:28658345-28658367 GAGGGTGAAAACAGGGTGGATGG - Intronic
1039704432 8:39992286-39992308 CAGAGTGATCTCAGGGTAGGTGG - Intronic
1041148410 8:54904646-54904668 CAGGGTGAACTTAGGCATAATGG + Intergenic
1043870566 8:85427081-85427103 CAAGGTGAAGTTAGGATTGATGG - Intronic
1044146688 8:88724844-88724866 CAGGGTGAATTTATGGCTGAGGG + Intergenic
1044416866 8:91948972-91948994 CAGGGTGAAGAAGGGGTTGAGGG - Intergenic
1044611283 8:94094795-94094817 CAGGGTGGTGTCAGGGTTCAAGG - Intergenic
1048730829 8:137438828-137438850 TAGGCTGAACTCATGGATGAAGG + Intergenic
1049212325 8:141392400-141392422 CAGGATGAACTCAGGGTAGGAGG - Intronic
1049602068 8:143512630-143512652 CCGGGTGAACTCAGGTTTCTGGG - Intronic
1052252308 9:26412699-26412721 CAGGCTGAACTCAGGCCTGTGGG - Intergenic
1052995528 9:34549918-34549940 CAGGCAGAACTCAGGGTTCAGGG + Intergenic
1056262004 9:84858249-84858271 CAGGGTGAAATCAGGATTATGGG - Intronic
1056719949 9:89063028-89063050 CATGGTGAAAGCAGGGTTGAGGG + Intronic
1058551978 9:106124484-106124506 CAGGCTGAGCTCAGGATTCAAGG + Intergenic
1059643919 9:116245236-116245258 CAGAGTGAATTCAGGGTTTGGGG - Intronic
1062403161 9:136381331-136381353 CAGGGTAAACACAGGGGTGCTGG + Exonic
1203744931 Un_GL000218v1:36361-36383 CAGGGAAAACTGAGGCTTGACGG - Intergenic
1203565175 Un_KI270744v1:83123-83145 CAGGGAAAACTGAGGCTTGACGG + Intergenic
1185612639 X:1401782-1401804 GAGGGTGAACTGAGGTCTGAGGG + Intergenic
1188967739 X:36575877-36575899 CAGGGTGAAGTCATGGGTCAGGG + Intergenic
1192562568 X:72137151-72137173 CAGGGTGGACTTGGGGTTCACGG - Intronic
1199655793 X:149994235-149994257 CATGGTGACCTCAGGGTGGTTGG + Intergenic
1199701392 X:150379145-150379167 CAGTGTGAACTCATGGTTTATGG - Intronic
1199885944 X:152022121-152022143 CATGGTGATCTCAGGGTGGTTGG - Intergenic
1199950022 X:152699633-152699655 CAGGGTGACCAGAGAGTTGAGGG + Intronic
1199959652 X:152768828-152768850 CAGGGTGACCAGAGAGTTGAGGG - Intronic
1200827444 Y:7659118-7659140 CATGGAGAACTCAAGGTTCAGGG + Intergenic