ID: 1078028432

View in Genome Browser
Species Human (GRCh38)
Location 11:7722456-7722478
Sequence CAGTGGTTCAAGATGGGAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078028427_1078028432 15 Left 1078028427 11:7722418-7722440 CCAAAGCAGGAGTGTGACATTGC No data
Right 1078028432 11:7722456-7722478 CAGTGGTTCAAGATGGGAGAGGG No data
1078028426_1078028432 16 Left 1078028426 11:7722417-7722439 CCCAAAGCAGGAGTGTGACATTG No data
Right 1078028432 11:7722456-7722478 CAGTGGTTCAAGATGGGAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078028432 Original CRISPR CAGTGGTTCAAGATGGGAGA GGG Intergenic
No off target data available for this crispr