ID: 1078028527

View in Genome Browser
Species Human (GRCh38)
Location 11:7723691-7723713
Sequence CTGGGGAAACAAAAGAAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078028527_1078028535 23 Left 1078028527 11:7723691-7723713 CCTTCCTTCTTTTGTTTCCCCAG No data
Right 1078028535 11:7723737-7723759 ATTCCCTTGCCCTGTGAATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078028527 Original CRISPR CTGGGGAAACAAAAGAAGGA AGG (reversed) Intergenic
No off target data available for this crispr