ID: 1078028904

View in Genome Browser
Species Human (GRCh38)
Location 11:7728416-7728438
Sequence CAGTGAGCCTATTCCTTCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078028900_1078028904 10 Left 1078028900 11:7728383-7728405 CCGTGCCCACCAGGAGGATGGGC No data
Right 1078028904 11:7728416-7728438 CAGTGAGCCTATTCCTTCTGTGG No data
1078028903_1078028904 1 Left 1078028903 11:7728392-7728414 CCAGGAGGATGGGCAATCACACT No data
Right 1078028904 11:7728416-7728438 CAGTGAGCCTATTCCTTCTGTGG No data
1078028895_1078028904 27 Left 1078028895 11:7728366-7728388 CCATTGATAGACAGTGGCCGTGC No data
Right 1078028904 11:7728416-7728438 CAGTGAGCCTATTCCTTCTGTGG No data
1078028902_1078028904 4 Left 1078028902 11:7728389-7728411 CCACCAGGAGGATGGGCAATCAC No data
Right 1078028904 11:7728416-7728438 CAGTGAGCCTATTCCTTCTGTGG No data
1078028901_1078028904 5 Left 1078028901 11:7728388-7728410 CCCACCAGGAGGATGGGCAATCA No data
Right 1078028904 11:7728416-7728438 CAGTGAGCCTATTCCTTCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078028904 Original CRISPR CAGTGAGCCTATTCCTTCTG TGG Intergenic
No off target data available for this crispr