ID: 1078035156

View in Genome Browser
Species Human (GRCh38)
Location 11:7796205-7796227
Sequence CAGGGTAACCACAGTGAGGT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 204
Summary {0: 1, 1: 0, 2: 8, 3: 19, 4: 176}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078035156 Original CRISPR CAGGGTAACCACAGTGAGGT GGG Exonic
900502797 1:3014867-3014889 CAGGGTAACCGCAGTGACACTGG + Intergenic
901724639 1:11231295-11231317 CAGGGTACACGCAGAGAGGTAGG - Exonic
906309171 1:44740721-44740743 TAGAATATCCACAGTGAGGTGGG - Intronic
906671977 1:47662713-47662735 CAGGGTAGGCAGAGTGAGGCTGG - Intergenic
912593901 1:110854675-110854697 CACTATGACCACAGTGAGGTGGG - Intergenic
912968686 1:114259988-114260010 CACAGTCACCACACTGAGGTGGG + Intergenic
913010101 1:114674823-114674845 CAGCTTCTCCACAGTGAGGTCGG + Exonic
915847229 1:159279227-159279249 GATGATAACCACAGTGAGGTGGG + Intergenic
915868776 1:159535261-159535283 GACAATAACCACAGTGAGGTGGG + Exonic
918379084 1:183936852-183936874 AAGGGTACCCACAGTGAGTCGGG + Exonic
918402891 1:184181166-184181188 CAGGGAACCCAAACTGAGGTGGG + Intergenic
919804834 1:201375379-201375401 CAGGGTGAGGACAGTGAGGGAGG + Intronic
924858298 1:247896314-247896336 AAGGGAGACCACAGTGAGATGGG - Exonic
924897936 1:248362404-248362426 GAGGATGACCACAGTCAGGTGGG - Exonic
924909063 1:248489328-248489350 GAGGATGACCACAGTCAGGTGGG - Exonic
924915042 1:248558730-248558752 GAGGATGACCACAGTCAGGTGGG + Exonic
1063883551 10:10554601-10554623 CAGGGTCACCACAGGGAGGCTGG - Intergenic
1067948607 10:50708736-50708758 CAGGGGAACCCCAGAGAGATGGG - Intergenic
1068150200 10:53121662-53121684 CAGGGTGAGGACACTGAGGTTGG + Intergenic
1068213745 10:53955343-53955365 CAGGGTAATCAGACTGAGTTAGG - Intronic
1070883930 10:79873733-79873755 CAGGGGAACCCCAGAGAGATGGG - Intergenic
1071650484 10:87390033-87390055 CAGGGGAACCCCAGAGAGATGGG - Intergenic
1075111170 10:119585908-119585930 CAGGAAAACCAGAGTGTGGTAGG - Intronic
1077548860 11:3190442-3190464 CAGGGAGACCACAGTTGGGTGGG + Intergenic
1077670900 11:4156748-4156770 CAGGGCAGTAACAGTGAGGTTGG - Intergenic
1078033042 11:7773073-7773095 GAGAGTAACCGCAGCGAGGTGGG + Intergenic
1078035156 11:7796205-7796227 CAGGGTAACCACAGTGAGGTGGG + Exonic
1078037755 11:7825223-7825245 CAGAGTGACTGCAGTGAGGTGGG + Exonic
1078039805 11:7849427-7849449 GATGGTGACGACAGTGAGGTGGG - Intergenic
1081783137 11:45727358-45727380 GAGGGTAGCCACAGTGGGGAGGG + Intergenic
1082139408 11:48590475-48590497 CAGGACAACCACAGTGATGCAGG - Intergenic
1082614659 11:55343919-55343941 GAGGGCAACCACAATGATGTGGG - Exonic
1082655841 11:55856316-55856338 CATAGTGACCACAGTCAGGTGGG - Intergenic
1082902190 11:58267136-58267158 CAGCAGCACCACAGTGAGGTGGG + Exonic
1083018204 11:59478154-59478176 CAGGGTCACCACAGTGATGTGGG - Exonic
1083019502 11:59492376-59492398 CAGGGTCACCACAGTGATGTGGG - Intergenic
1083020719 11:59504300-59504322 CAGGGTCACCACAGTGATGTGGG - Exonic
1083021840 11:59515637-59515659 CAGGGTCACCACGGTGATGTGGG - Exonic
1083023750 11:59532509-59532531 CAGGGTCACCACAGTGATGTGGG - Intergenic
1083045318 11:59729249-59729271 CAGGAGAACCACAATGAGGTGGG - Intronic
1083047427 11:59749369-59749391 GAGGAGAACCACAGTCAGGTGGG - Intronic
1083699118 11:64462942-64462964 CAGTGTAATAATAGTGAGGTAGG - Intergenic
1083843247 11:65316283-65316305 CAGGGCAATCACAGAGAGCTAGG + Intronic
1084276286 11:68052649-68052671 CAGGGAAACCAGAGTGTGCTGGG + Intergenic
1086203963 11:84236304-84236326 CAGGGAAATATCAGTGAGGTTGG + Intronic
1086503476 11:87478009-87478031 CAGGGCATGCACTGTGAGGTTGG - Intergenic
1086894804 11:92299579-92299601 CAAGGTAACAACAGAGGGGTGGG + Intergenic
1087732335 11:101793029-101793051 CAGGGTAAGCACAGTGCAGTGGG + Intronic
1088560249 11:111107700-111107722 CAGAGAAAACACAGTGAGCTGGG - Intergenic
1089459401 11:118643897-118643919 CAGGGTAGCCACGCTGAGCTGGG - Exonic
1091165755 11:133474696-133474718 GAGGGCAACCAGAGTGAGCTGGG - Intronic
1092965159 12:13634387-13634409 TCGTGTAACCACATTGAGGTTGG + Intronic
1095349246 12:41189100-41189122 CAGGGTAAGCAAAGGGGGGTGGG + Exonic
1095395579 12:41758604-41758626 CAACATAACCACAATGAGGTGGG - Intergenic
1104938921 12:132385731-132385753 CAGGGAAAACACAGAGAGGCTGG + Intergenic
1109477956 13:62909506-62909528 CAGGTTAACAACAGTTAAGTAGG + Intergenic
1113574720 13:111387111-111387133 CAGGGTGTCCACAGTGATGGTGG + Intergenic
1113899140 13:113786636-113786658 GAGGGTAACGACAGTGATGATGG - Intronic
1114140675 14:19906403-19906425 CAGGGTCACCACAGTCACGTGGG - Intergenic
1114152573 14:20060769-20060791 CAGAGTGACCACAATGATGTGGG - Exonic
1114334110 14:21670177-21670199 CAGTGTAACTACAGTGAGATGGG + Intergenic
1119480429 14:74954937-74954959 CAGGGAAGCCACAGGGAGGGAGG - Intronic
1120310733 14:82824441-82824463 CAAGATAAACACTGTGAGGTAGG + Intergenic
1122038509 14:98965290-98965312 CAGGCTCACCACAGGCAGGTGGG + Intergenic
1123003432 14:105309258-105309280 CAGGATAACCACAGTCAAGAGGG + Exonic
1124233726 15:27968781-27968803 CAGGGAAACCACACAGAGGCGGG + Intronic
1126789594 15:52209046-52209068 CAGGGAAACCTCAGAGAGGAAGG + Intronic
1126969249 15:54091103-54091125 CAGGGGAACCCCACTGAGGAAGG - Intronic
1128592127 15:68908615-68908637 CAGGGAAAGCCCAGTGAGGCTGG + Intronic
1134021299 16:10923322-10923344 CAGGGTAACCAGGGTGGGCTTGG + Exonic
1134666037 16:16019479-16019501 CAGGGTAAACAGAGTCTGGTTGG + Intronic
1135381054 16:21996419-21996441 CAGGCTACCCACAGTGAGTTTGG + Intronic
1135894440 16:26386138-26386160 CAGGGAAAGCAGAGTGAGGCTGG - Intergenic
1138264531 16:55651058-55651080 CAGGGACACCACCATGAGGTGGG + Intergenic
1139927817 16:70501058-70501080 CAGGGTGACCTCAGTCAGGATGG + Exonic
1141666802 16:85469942-85469964 GCGGGGAACCACAGTGAGGATGG - Intergenic
1142931822 17:3291824-3291846 TATGGCAACCACAGTGAGGTGGG + Exonic
1142946411 17:3433065-3433087 CAGTGACACCACAGAGAGGTGGG + Exonic
1145757697 17:27404733-27404755 CTGGGAAACCACAGTGAAATGGG - Intergenic
1146605689 17:34255712-34255734 CAGGGTAATCAAAGAGAGGGTGG + Intronic
1146929681 17:36768414-36768436 CAGGGAAGCCACGGTGTGGTGGG + Intergenic
1147690156 17:42309902-42309924 CTGGCTATCCACAGTGAGGAAGG - Intronic
1150493300 17:65589071-65589093 CAGGGTTCCCACAGTGAGGTGGG - Intronic
1151361572 17:73592467-73592489 CAGGCCAACCACATGGAGGTGGG + Intronic
1151876464 17:76870151-76870173 CAGGGGGACCACAGTGGGGCTGG - Intronic
1153159943 18:2192776-2192798 CAGAGTAATCACAGTGAGATTGG - Intergenic
1155177615 18:23314439-23314461 CAGGGTAAGCACATTGCAGTAGG - Intronic
1158748932 18:60236173-60236195 CAGGGTAACAACAGTGAGGATGG - Intergenic
1159893909 18:73978855-73978877 CAGGGTGAGCACAGAGAGCTAGG + Intergenic
1161689176 19:5720892-5720914 AAGGGGAGCCTCAGTGAGGTTGG - Intronic
1161967493 19:7556552-7556574 CAGGATAAGCAGATTGAGGTAGG + Exonic
1162720775 19:12661338-12661360 CATGGTCATCACAGTGTGGTTGG + Exonic
1163066393 19:14799387-14799409 CAAGGTGACCACTGAGAGGTGGG + Exonic
1163198327 19:15742126-15742148 CATGACCACCACAGTGAGGTGGG - Exonic
1165793604 19:38506340-38506362 CAGGGTAACAGCACTAAGGTCGG - Exonic
1167077418 19:47257892-47257914 CAGGATGAGCACAGGGAGGTGGG + Intronic
925801869 2:7609654-7609676 GAGGGGAACCACTCTGAGGTGGG - Intergenic
926012884 2:9422873-9422895 CAGGGTCACCAGAGTAAGGACGG + Exonic
927336763 2:21933525-21933547 CAGGGTCACCACAGGTAAGTAGG + Intergenic
928688702 2:33776318-33776340 CAAGGTTTCCACAGTGAGGAAGG - Intergenic
931846943 2:66213751-66213773 CTCAGTCACCACAGTGAGGTAGG - Intergenic
935580347 2:104750739-104750761 CAGGGTGAAGACAGGGAGGTGGG - Intergenic
935815921 2:106845629-106845651 CAAGGTGACCACATTGAGGTAGG - Intronic
935848469 2:107192668-107192690 GAGGGTAACCACCAGGAGGTGGG + Intergenic
936473170 2:112816571-112816593 CAGGGTAACCCAAGTGATTTTGG + Intergenic
937867317 2:126762369-126762391 CAGGTTAGCCTCGGTGAGGTGGG - Intergenic
938109223 2:128552987-128553009 ACGGGGAACCACAGTGATGTTGG - Intergenic
939319142 2:140593350-140593372 CAGGGTAACTGCAGGGAGATAGG + Intronic
940826343 2:158416735-158416757 CTGGGTAAAGACAGAGAGGTTGG - Intronic
943954645 2:194173437-194173459 CAGGGTAAATAGAGTAAGGTAGG - Intergenic
945933925 2:215883912-215883934 CAGGGGAACCACAGTGTGTCAGG - Intergenic
946607817 2:221425019-221425041 CAGGGAAACCACACTGTGTTTGG + Intronic
946777150 2:223155291-223155313 CAGGGAAACCATAGAGAGGGGGG - Intronic
947678304 2:232005642-232005664 CAGGGTAAACAAAGGGAGGAAGG - Intronic
1168819882 20:765628-765650 CTGGATGACCACCGTGAGGTAGG + Exonic
1172846099 20:37930771-37930793 CAGGGCACCCAGGGTGAGGTGGG - Intronic
1176020602 20:62960702-62960724 CAGGGCCACCATGGTGAGGTGGG + Intronic
1180611663 22:17102154-17102176 CAGGGTCTCCACGGTGATGTTGG - Exonic
1181001712 22:19990825-19990847 CAGAGTAAGCTCAGTGGGGTGGG + Intronic
1181513888 22:23400852-23400874 CAGGGCAACCACAGGGAGGAGGG + Intergenic
1181696528 22:24595422-24595444 CAGGGTAACCCCAGGGAGACGGG - Intronic
1182422107 22:30253727-30253749 CAGGGTGGCCCCAGTGAGCTTGG - Intergenic
1182967116 22:34532722-34532744 CAGGGGGACTACAGTGAGGGAGG - Intergenic
1183899479 22:40994138-40994160 CAGGGAAATGACAGAGAGGTTGG + Intergenic
1184217140 22:43075279-43075301 CAGGGTGAACACAGTGATGTGGG + Intronic
1184262604 22:43328017-43328039 AAGGGAAACCACAAGGAGGTTGG + Intronic
1184405324 22:44297568-44297590 CAGAGCTACCACCGTGAGGTGGG - Intronic
949565196 3:5237988-5238010 CAGGGAAACGCCAGAGAGGTTGG + Intergenic
949706793 3:6827673-6827695 CAGGGTAGCCACAGTGCCGTAGG - Intronic
950573453 3:13816417-13816439 CTGGGAACCCACAGTGAGGGAGG + Exonic
950788138 3:15452549-15452571 CTGTGTAACCACAGTGAGCGTGG + Intronic
953823278 3:46228200-46228222 CAGGGTGTCCCCAGTGAGATTGG - Intronic
954943253 3:54394031-54394053 CAGAGTTACCACTATGAGGTAGG + Intronic
955267787 3:57464057-57464079 CAGGGTAGAAACAGTGAGTTGGG - Intronic
956788302 3:72660969-72660991 CAGGGTACACACAGTGGGGTGGG + Intergenic
956864127 3:73352665-73352687 TAGGGTAACCCAAGTGAGGCAGG - Intergenic
958932370 3:100221351-100221373 CAGGCTAACCACAGGGAGTCAGG - Intergenic
958985067 3:100770804-100770826 CACGGTGACCACAGTGAGGTTGG + Exonic
959427761 3:106214030-106214052 AAGGGTAACCAAAGTAGGGTGGG + Intergenic
960705218 3:120475079-120475101 AGGGGTAACCTCAGTGAGATGGG + Intergenic
961022612 3:123521654-123521676 CAGAGTCACCACAGGGAGGAGGG + Intronic
961475972 3:127146531-127146553 CAGGGGAAACACAGAAAGGTTGG - Intergenic
966914778 3:184578612-184578634 CAGGGTACCCGGAGTGAGATAGG - Intronic
969340295 4:6536080-6536102 CAGGCTACACAGAGTGAGGTGGG - Intronic
976768205 4:88620768-88620790 CAGGGTAAACACTCTGAGGAGGG - Intronic
977916675 4:102601863-102601885 TAGGGGAAAGACAGTGAGGTGGG - Intronic
982215789 4:153081694-153081716 CAGGAGAACCAGAGTGTGGTGGG - Intergenic
982325698 4:154126495-154126517 AAGGGTAACAACAGTGAAGGAGG - Intergenic
982761543 4:159290146-159290168 CAGTGGCACCACAGTGAAGTGGG + Intronic
993096947 5:83490365-83490387 CAGCTTGACCACAGTGAGGGAGG - Exonic
995696443 5:114883525-114883547 CAGGGAAACAAAAGTGAGGGGGG + Intergenic
996034223 5:118740014-118740036 CAGGGTCACCACAGCCAGATGGG + Intergenic
997422701 5:133781657-133781679 CAGGGTACACACAGTGTGGCAGG - Intergenic
1001976850 5:176007178-176007200 CAGGGTGACCAGAGACAGGTGGG - Intronic
1002240578 5:177836602-177836624 CAGGGTGACCAGAGACAGGTGGG + Intergenic
1005664261 6:28034644-28034666 CAAGGAGACCACGGTGAGGTGGG - Intergenic
1005665840 6:28053417-28053439 CAGGGAAACCACTGTGAGGTGGG + Intergenic
1005804607 6:29462491-29462513 GAGGGTGACCACAGTGAGATGGG - Exonic
1005818202 6:29574619-29574641 GAGGGTGACCACAGTGAGATGGG - Intronic
1005819839 6:29588666-29588688 GAGGGTGACCACAGTGAGATGGG - Exonic
1007935127 6:45726217-45726239 CAGAGTGCCCAGAGTGAGGTGGG + Intergenic
1014814914 6:125924865-125924887 CAGGGGACCCACAGTGAGAGAGG - Intronic
1014999820 6:128200999-128201021 CAGGGTAGGCTCAGTAAGGTAGG - Intronic
1015419918 6:132995647-132995669 CAGGGTTACCAGAGTGGGGCTGG - Intergenic
1015591515 6:134827240-134827262 CAGGCTGACCGCAGGGAGGTGGG + Intergenic
1016459263 6:144264929-144264951 CAAGGTAACCACTGAGAGGCTGG + Intergenic
1017371070 6:153709778-153709800 CAGGGTAGGGACAGTGAGGGTGG + Intergenic
1019089278 6:169513207-169513229 CATGGTGGCCTCAGTGAGGTGGG + Intronic
1020113615 7:5462362-5462384 GTGGGTACCCACAGTGGGGTAGG - Intronic
1021275272 7:18642360-18642382 CAGGGGAACCACAGAAAAGTAGG - Intronic
1022687671 7:32611829-32611851 CAGAGAAAACACACTGAGGTTGG - Intergenic
1023852647 7:44158852-44158874 CTGGATAGCCACAGTGAGGAGGG + Intronic
1025029963 7:55548956-55548978 CAGGGTGACCACAGTGAGACTGG + Intronic
1026586644 7:71661091-71661113 CATTGTAACCACAGTGAGCAGGG - Intronic
1029333066 7:99876287-99876309 AAGAGAAACCACCGTGAGGTGGG + Exonic
1029850924 7:103461150-103461172 AAGGGCAACCAGAGAGAGGTCGG - Intergenic
1031682521 7:124692074-124692096 CAGTGTAACCTCAATGAGGCAGG - Intergenic
1032951392 7:136918483-136918505 GAGGGTAGCAACAGTGAGATGGG - Intronic
1033670525 7:143488654-143488676 TATGGAGACCACAGTGAGGTGGG + Intergenic
1036296300 8:7540926-7540948 CAGAGAGACCACAGTGAGGGAGG - Intronic
1036326266 8:7780093-7780115 CAGAGAGACCACAGTGAGGGAGG + Intronic
1042506175 8:69563206-69563228 CAGGGAAACCACAGAGCGTTGGG - Intronic
1043400481 8:79879583-79879605 CAGGGTGAGCATAGAGAGGTGGG + Intergenic
1047927468 8:129695594-129695616 CATGCTGACCACAGGGAGGTGGG - Intergenic
1048215084 8:132486769-132486791 CAGGGAGACCACAGTCAGGATGG - Intergenic
1048346771 8:133581730-133581752 CAGGGAATCCACAGTTTGGTGGG + Intergenic
1048514538 8:135093986-135094008 CAGGGAACCCACAGTCAAGTAGG + Intergenic
1048608548 8:135996497-135996519 CAAGGTAACCACAATGAAGGAGG + Intergenic
1049212551 8:141393367-141393389 CTTCGTAACCACAGTGAGGGGGG - Intronic
1055715238 9:79110382-79110404 CTGGGTACCCACAATCAGGTGGG - Intergenic
1057016555 9:91657565-91657587 CTGGGTACCAACAGTGGGGTAGG - Intronic
1057901865 9:98955359-98955381 CAAGGAACCCACAGTGATGTGGG - Intronic
1060197993 9:121635607-121635629 CAGGGCAACCACAGGAAGGAGGG + Intronic
1060325924 9:122615465-122615487 TATGGCCACCACAGTGAGGTGGG - Exonic
1060331565 9:122675857-122675879 CAGAATCACCACAGTGAGATGGG - Exonic
1060336120 9:122724720-122724742 CAGGACCACTACAGTGAGGTGGG - Exonic
1061804680 9:133131351-133131373 CAGGGTGAGTACAGGGAGGTAGG - Intronic
1186380512 X:9053899-9053921 CAGGGTGACCACAGTTGGCTGGG - Intronic
1187148285 X:16657431-16657453 CAGGGTGACCAAAGTGAACTGGG + Intronic
1188926848 X:36054209-36054231 CTGGGTAGCCACAGTGGGGGTGG - Intronic
1191115291 X:56846236-56846258 CAGGGTATCCACAAGGAGGCTGG - Intergenic
1193515527 X:82457379-82457401 CAGAGAAACCAAAGTGAGGAGGG - Intergenic
1198918727 X:141701314-141701336 CAGGGGAACGAAGGTGAGGTTGG - Intergenic
1199069170 X:143456556-143456578 CAGGCTGTCCACAGTGAGTTAGG + Intergenic